Incidental Mutation 'R0356:Hspa12b'
ID65390
Institutional Source Beutler Lab
Gene Symbol Hspa12b
Ensembl Gene ENSMUSG00000074793
Gene Nameheat shock protein 12B
Synonyms2700081N06Rik
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0356 (G1)
Quality Score118
Status Validated
Chromosome2
Chromosomal Location131127280-131146321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 131144799 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 547 (V547L)
Ref Sequence ENSEMBL: ENSMUSP00000096950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028800] [ENSMUST00000099349] [ENSMUST00000103188] [ENSMUST00000127862] [ENSMUST00000133602] [ENSMUST00000184121] [ENSMUST00000184535]
Predicted Effect probably benign
Transcript: ENSMUST00000028800
SMART Domains Protein: ENSMUSP00000028800
Gene: ENSMUSG00000027327

DomainStartEndE-ValueType
Pfam:DUF4517 30 177 1.6e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099349
AA Change: V547L

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096950
Gene: ENSMUSG00000074793
AA Change: V547L

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
SCOP:d1bupa1 62 248 3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103188
SMART Domains Protein: ENSMUSP00000099477
Gene: ENSMUSG00000027327

DomainStartEndE-ValueType
Pfam:DUF4517 27 174 1.1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127862
Predicted Effect probably benign
Transcript: ENSMUST00000133602
SMART Domains Protein: ENSMUSP00000115000
Gene: ENSMUSG00000027327

DomainStartEndE-ValueType
Pfam:DUF4517 27 140 3.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152961
Predicted Effect probably benign
Transcript: ENSMUST00000184121
Predicted Effect probably benign
Transcript: ENSMUST00000184535
Meta Mutation Damage Score 0.1250 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an atypical heat shock protein 70 (Hsp70) ATPase domain and is therefore a distant member of the mammalian Hsp70 family. This gene may be involved in susceptibility to atherosclerosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Hspa12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Hspa12b APN 2 131134120 missense probably damaging 1.00
IGL01643:Hspa12b APN 2 131142697 missense probably damaging 1.00
IGL02145:Hspa12b APN 2 131143735 unclassified probably benign
IGL02441:Hspa12b APN 2 131138595 missense probably null 1.00
R1458:Hspa12b UTSW 2 131145192 missense probably damaging 0.98
R1618:Hspa12b UTSW 2 131140929 missense probably benign
R1734:Hspa12b UTSW 2 131138536 missense possibly damaging 0.82
R2149:Hspa12b UTSW 2 131143057 missense probably damaging 0.98
R4091:Hspa12b UTSW 2 131133488 unclassified probably null
R4234:Hspa12b UTSW 2 131139012 missense probably benign 0.00
R4235:Hspa12b UTSW 2 131139012 missense probably benign 0.00
R4243:Hspa12b UTSW 2 131141858 missense possibly damaging 0.90
R5133:Hspa12b UTSW 2 131139508 missense possibly damaging 0.86
R5134:Hspa12b UTSW 2 131139508 missense possibly damaging 0.86
R5228:Hspa12b UTSW 2 131142964 missense possibly damaging 0.82
R6358:Hspa12b UTSW 2 131137066 critical splice donor site probably benign
R7555:Hspa12b UTSW 2 131138476 missense probably damaging 1.00
R8035:Hspa12b UTSW 2 131140939 missense probably damaging 1.00
R8117:Hspa12b UTSW 2 131138469 missense possibly damaging 0.79
X0065:Hspa12b UTSW 2 131144561 splice site probably null
Predicted Primers PCR Primer
(F):5'- CATGCAGAGATGCTGCTGGCTAAG -3'
(R):5'- TACAGATTGATGAGCACACGCCGC -3'

Sequencing Primer
(F):5'- CTGGCTAAGCCTGAGGTG -3'
(R):5'- ACGAAGCGCTCAAAGACATC -3'
Posted On2013-08-08