Mutagenetix > Incidental Mutation

Incidental Mutation 'R8434:Mast4'

653915

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

067900-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R8434 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102868994-103471005 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 102897900 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 838 (H838Q)

Ref Sequence

ENSEMBL: ENSMUSP00000128464 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]

AlphaFold

Q811L6

Predicted Effect

probably damaging
Transcript: ENSMUST00000099202
AA Change: H661Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: H661Q

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166726
AA Change: H838Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751
AA Change: H838Q

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167058
AA Change: H838Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: H838Q

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167462
AA Change: H646Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751
AA Change: H646Q

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	3e-145	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	843	878	N/A	INTRINSIC
PDZ	888	968	2.34e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171791
AA Change: H646Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: H646Q

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172264
AA Change: H634Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751
AA Change: H634Q

Domain	Start	End	E-Value	Type
Pfam:DUF1908	49	326	4.1e-147	PFAM
S_TKc	364	637	4.13e-98	SMART
S_TK_X	638	702	3.79e-2	SMART
low complexity region	718	731	N/A	INTRINSIC
low complexity region	791	804	N/A	INTRINSIC
low complexity region	813	830	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194446
AA Change: H670Q

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 137,773,021 (GRCm39)	T737A	probably damaging	Het
2310034C09Rik	A	G	16: 88,556,260 (GRCm39)	Y158C	probably damaging	Het
Abhd18	T	A	3: 40,885,331 (GRCm39)	S239T	possibly damaging	Het
Ankrd13b	G	A	11: 77,368,552 (GRCm39)	T56I	probably benign	Het
Arhgef10l	T	A	4: 140,291,582 (GRCm39)	Q454L	possibly damaging	Het
Atp1a2	T	C	1: 172,112,179 (GRCm39)	E572G	probably benign	Het
Cdk5rap2	T	C	4: 70,282,257 (GRCm39)	H164R	probably benign	Het
Clca4b	A	G	3: 144,631,917 (GRCm39)	M196T	probably benign	Het
Cnbd1	T	G	4: 19,055,045 (GRCm39)	K127T	probably benign	Het
Cog3	A	T	14: 75,979,836 (GRCm39)	V165E	probably damaging	Het
Crim1	G	A	17: 78,654,686 (GRCm39)	R654H	probably benign	Het
Ctnnb1	G	A	9: 120,786,628 (GRCm39)	V617I	possibly damaging	Het
Dach1	T	A	14: 98,406,129 (GRCm39)	Q206L	probably damaging	Het
Dhx30	C	T	9: 109,929,974 (GRCm39)	V41I	probably benign	Het
Dnase2a	T	C	8: 85,636,410 (GRCm39)	L176P	probably damaging	Het
Dpp10	T	C	1: 123,360,739 (GRCm39)	D262G	probably damaging	Het
Dsel	T	A	1: 111,789,385 (GRCm39)	E383D	probably damaging	Het
Flt1	T	A	5: 147,576,253 (GRCm39)	Y585F	probably damaging	Het
Fubp1	T	A	3: 151,926,190 (GRCm39)	I304N	probably damaging	Het
Gab2	A	G	7: 96,948,337 (GRCm39)	D309G	probably damaging	Het
Gon4l	T	C	3: 88,762,086 (GRCm39)	V291A	probably damaging	Het
Gpam	C	T	19: 55,070,063 (GRCm39)	V398M	possibly damaging	Het
Grin3b	C	T	10: 79,810,422 (GRCm39)	R643C	probably damaging	Het
Hdac3	T	A	18: 38,074,475 (GRCm39)	H339L	possibly damaging	Het
Hsdl2	A	T	4: 59,610,621 (GRCm39)	Q326L	unknown	Het
Insr	T	C	8: 3,215,514 (GRCm39)		probably benign	Het
Ivl	T	A	3: 92,479,943 (GRCm39)	T41S	probably benign	Het
Lama4	C	T	10: 38,902,703 (GRCm39)	P226S	possibly damaging	Het
Lpin1	A	G	12: 16,613,621 (GRCm39)		probably null	Het
Lrrc42	A	T	4: 107,104,721 (GRCm39)	N81K	probably damaging	Het
Mcmdc2	A	G	1: 9,990,806 (GRCm39)	M314V	possibly damaging	Het
Me3	A	G	7: 89,389,086 (GRCm39)	E130G	probably damaging	Het
Mpnd	A	G	17: 56,316,405 (GRCm39)	D28G	possibly damaging	Het
Mtch2	G	T	2: 90,683,208 (GRCm39)	E102*	probably null	Het
Myh13	A	T	11: 67,254,011 (GRCm39)		probably null	Het
Or10ag55-ps1	G	A	2: 87,114,978 (GRCm39)	V115I	probably benign	Het
Or5ae2	C	A	7: 84,506,497 (GRCm39)	H309N	probably benign	Het
Plch2	T	A	4: 155,074,192 (GRCm39)	D891V	probably damaging	Het
Ppfibp2	T	C	7: 107,327,957 (GRCm39)		probably null	Het
Rag1	A	G	2: 101,473,009 (GRCm39)	L711P	probably damaging	Het
Sacs	T	A	14: 61,450,636 (GRCm39)	Y4227*	probably null	Het
Sec23ip	C	T	7: 128,352,151 (GRCm39)	H176Y	probably benign	Het
Sema3a	T	C	5: 13,523,487 (GRCm39)		probably null	Het
Serpina10	C	T	12: 103,594,563 (GRCm39)	G219R	probably damaging	Het
Sp1	C	T	15: 102,318,118 (GRCm39)	L546F	probably benign	Het
Syne1	T	C	10: 5,073,057 (GRCm39)	N1256S	probably benign	Het
Tbc1d5	G	T	17: 51,089,455 (GRCm39)		probably benign	Het
Tns1	T	C	1: 73,964,765 (GRCm39)	S33G	probably benign	Het
Tpsab1	A	G	17: 25,564,445 (GRCm39)	L3P	possibly damaging	Het
Trgv3	A	G	13: 19,427,036 (GRCm39)	T8A	probably benign	Het
Vav2	A	T	2: 27,159,050 (GRCm39)		probably benign	Het
Vmn1r44	T	C	6: 89,870,610 (GRCm39)	S119P	possibly damaging	Het
Vmn2r31	A	G	7: 7,387,699 (GRCm39)	L624P	probably damaging	Het
Vps33a	A	T	5: 123,671,944 (GRCm39)	W475R	possibly damaging	Het
Xpnpep3	G	T	15: 81,311,795 (GRCm39)	R167L	possibly damaging	Het
Zfhx4	T	A	3: 5,463,918 (GRCm39)	S1384T	probably damaging	Het
Zfp3	G	A	11: 70,663,384 (GRCm39)	E448K	probably benign	Het
Zfp362	T	A	4: 128,679,769 (GRCm39)	H299L	probably damaging	Het
Zfp664	C	T	5: 124,962,827 (GRCm39)	L74F	possibly damaging	Het
Zfp808	A	G	13: 62,319,926 (GRCm39)	Y385C	probably damaging	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102,907,275 (GRCm39)	nonsense	probably null
IGL00933:Mast4	APN	13	102,871,874 (GRCm39)	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102,910,744 (GRCm39)	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102,890,576 (GRCm39)	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102,897,523 (GRCm39)	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102,904,401 (GRCm39)	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102,887,020 (GRCm39)	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102,874,123 (GRCm39)	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102,873,749 (GRCm39)	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102,910,781 (GRCm39)	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102,874,482 (GRCm39)	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102,878,545 (GRCm39)	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102,872,004 (GRCm39)	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102,990,331 (GRCm39)	makesense	probably null
IGL02850:Mast4	APN	13	102,890,740 (GRCm39)	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102,872,184 (GRCm39)	missense	probably benign
IGL03064:Mast4	APN	13	102,897,472 (GRCm39)	nonsense	probably null
IGL03124:Mast4	APN	13	102,874,753 (GRCm39)	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102,874,163 (GRCm39)	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102,890,764 (GRCm39)	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102,887,905 (GRCm39)	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102,873,615 (GRCm39)	missense	possibly damaging	0.46
buck	UTSW	13	102,897,801 (GRCm39)	critical splice donor site	probably null
doe	UTSW	13	103,042,185 (GRCm39)	missense	possibly damaging	0.85
skinnybones	UTSW	13	102,941,149 (GRCm39)	critical splice donor site	probably null
BB010:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
BB020:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
FR4304:Mast4	UTSW	13	102,871,370 (GRCm39)	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102,872,825 (GRCm39)	small insertion	probably benign
FR4340:Mast4	UTSW	13	102,871,365 (GRCm39)	frame shift	probably null
FR4548:Mast4	UTSW	13	102,872,826 (GRCm39)	small insertion	probably benign
FR4976:Mast4	UTSW	13	102,875,755 (GRCm39)	frame shift	probably null
FR4976:Mast4	UTSW	13	102,872,820 (GRCm39)	small insertion	probably benign
NA:Mast4	UTSW	13	102,878,565 (GRCm39)	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102,878,566 (GRCm39)	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103,470,723 (GRCm39)	start gained	probably benign
R0242:Mast4	UTSW	13	102,990,350 (GRCm39)	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102,890,669 (GRCm39)	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102,871,781 (GRCm39)	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102,888,068 (GRCm39)	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102,895,252 (GRCm39)	splice site	probably benign
R0744:Mast4	UTSW	13	102,873,895 (GRCm39)	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102,990,408 (GRCm39)	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102,907,292 (GRCm39)	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102,872,004 (GRCm39)	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102,887,086 (GRCm39)	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102,872,916 (GRCm39)	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102,872,916 (GRCm39)	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102,909,027 (GRCm39)	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102,873,431 (GRCm39)	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102,875,771 (GRCm39)	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102,930,625 (GRCm39)	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102,887,917 (GRCm39)	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102,875,354 (GRCm39)	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102,895,601 (GRCm39)	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102,887,054 (GRCm39)	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102,890,713 (GRCm39)	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102,871,983 (GRCm39)	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102,872,259 (GRCm39)	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102,934,715 (GRCm39)	splice site	probably benign
R2370:Mast4	UTSW	13	102,910,695 (GRCm39)	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102,875,147 (GRCm39)	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102,990,350 (GRCm39)	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102,872,939 (GRCm39)	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102,990,434 (GRCm39)	splice site	probably benign
R3434:Mast4	UTSW	13	102,923,887 (GRCm39)	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102,923,887 (GRCm39)	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102,923,927 (GRCm39)	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102,895,177 (GRCm39)	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4021:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4022:Mast4	UTSW	13	102,990,377 (GRCm39)	missense	probably damaging	1.00
R4022:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4210:Mast4	UTSW	13	102,875,713 (GRCm39)	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102,910,756 (GRCm39)	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102,873,766 (GRCm39)	nonsense	probably null
R4627:Mast4	UTSW	13	103,470,529 (GRCm39)	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103,470,627 (GRCm39)	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102,909,080 (GRCm39)	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102,909,080 (GRCm39)	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102,910,692 (GRCm39)	critical splice donor site	probably null
R4995:Mast4	UTSW	13	103,042,262 (GRCm39)	intron	probably benign
R5059:Mast4	UTSW	13	102,887,071 (GRCm39)	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102,875,391 (GRCm39)	nonsense	probably null
R5101:Mast4	UTSW	13	102,872,864 (GRCm39)	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102,890,723 (GRCm39)	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102,873,987 (GRCm39)	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102,930,580 (GRCm39)	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102,910,701 (GRCm39)	nonsense	probably null
R5906:Mast4	UTSW	13	102,872,252 (GRCm39)	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102,874,764 (GRCm39)	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102,872,148 (GRCm39)	missense	probably benign
R5987:Mast4	UTSW	13	102,895,242 (GRCm39)	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102,990,391 (GRCm39)	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102,923,929 (GRCm39)	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102,923,929 (GRCm39)	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102,872,717 (GRCm39)	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102,897,890 (GRCm39)	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102,872,493 (GRCm39)	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	103,042,185 (GRCm39)	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102,897,801 (GRCm39)	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102,874,004 (GRCm39)	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102,941,222 (GRCm39)	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102,934,586 (GRCm39)	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102,872,482 (GRCm39)	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102,874,223 (GRCm39)	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103,470,508 (GRCm39)	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102,874,986 (GRCm39)	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102,930,511 (GRCm39)	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102,887,932 (GRCm39)	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102,941,149 (GRCm39)	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102,923,934 (GRCm39)	nonsense	probably null
R7697:Mast4	UTSW	13	102,875,711 (GRCm39)	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102,890,596 (GRCm39)	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102,875,783 (GRCm39)	missense	probably damaging	1.00
R7933:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
R8042:Mast4	UTSW	13	102,917,753 (GRCm39)	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102,874,184 (GRCm39)	missense	possibly damaging	0.89
R8172:Mast4	UTSW	13	103,089,633 (GRCm39)	critical splice donor site	probably null
R8206:Mast4	UTSW	13	102,872,247 (GRCm39)	missense	probably damaging	1.00
R8248:Mast4	UTSW	13	102,875,229 (GRCm39)	missense	probably damaging	1.00
R8283:Mast4	UTSW	13	102,895,177 (GRCm39)	missense	probably damaging	1.00
R8346:Mast4	UTSW	13	102,887,986 (GRCm39)	missense	probably damaging	0.99
R8796:Mast4	UTSW	13	102,919,899 (GRCm39)	missense	probably benign	0.07
R8850:Mast4	UTSW	13	102,895,174 (GRCm39)	missense	probably damaging	1.00
R9012:Mast4	UTSW	13	102,934,606 (GRCm39)	missense	probably benign	0.05
R9375:Mast4	UTSW	13	102,917,753 (GRCm39)	missense	probably damaging	0.99
R9389:Mast4	UTSW	13	103,470,438 (GRCm39)	missense	probably benign	0.00
R9404:Mast4	UTSW	13	102,887,933 (GRCm39)	missense	probably damaging	1.00
R9520:Mast4	UTSW	13	102,925,532 (GRCm39)	missense	probably damaging	1.00
R9525:Mast4	UTSW	13	102,872,944 (GRCm39)	missense	probably benign	0.00
R9526:Mast4	UTSW	13	102,873,593 (GRCm39)	missense	probably benign	0.00
R9709:Mast4	UTSW	13	102,910,711 (GRCm39)	missense	probably damaging	1.00
R9790:Mast4	UTSW	13	102,890,705 (GRCm39)	missense	probably benign	0.01
R9791:Mast4	UTSW	13	102,890,705 (GRCm39)	missense	probably benign	0.01
RF005:Mast4	UTSW	13	102,872,815 (GRCm39)	small insertion	probably benign
RF015:Mast4	UTSW	13	102,875,755 (GRCm39)	frame shift	probably null
RF019:Mast4	UTSW	13	102,872,815 (GRCm39)	small insertion	probably benign
RF037:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
RF039:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
RF040:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
Z1088:Mast4	UTSW	13	102,875,027 (GRCm39)	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102,874,968 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGAACAACAGGGAGCTTTC -3'
(R):5'- AGCAAAATCTGATTTCCTGCTG -3'

Sequencing Primer
(F):5'- CAACAGGGAGCTTTCTAGAATTTG -3'
(R):5'- TGTACAGAGGGTGGTTCA -3'

Posted On

2020-10-20