Incidental Mutation 'R8434:Crim1'
ID 653924
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Name cysteine rich transmembrane BMP regulator 1 (chordin like)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8434 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 78200248-78376592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78347257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 654 (R654H)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112498]
AlphaFold Q9JLL0
Predicted Effect probably benign
Transcript: ENSMUST00000112498
AA Change: R654H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: R654H

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,260 T737A probably damaging Het
2310034C09Rik A G 16: 88,759,372 Y158C probably damaging Het
Abhd18 T A 3: 40,930,896 S239T possibly damaging Het
Ankrd13b G A 11: 77,477,726 T56I probably benign Het
Arhgef10l T A 4: 140,564,271 Q454L possibly damaging Het
Atp1a2 T C 1: 172,284,612 E572G probably benign Het
Cdk5rap2 T C 4: 70,364,020 H164R probably benign Het
Clca4b A G 3: 144,926,156 M196T probably benign Het
Cnbd1 T G 4: 19,055,045 K127T probably benign Het
Cog3 A T 14: 75,742,396 V165E probably damaging Het
Ctnnb1 G A 9: 120,957,562 V617I possibly damaging Het
Dach1 T A 14: 98,168,693 Q206L probably damaging Het
Dhx30 C T 9: 110,100,906 V41I probably benign Het
Dnase2a T C 8: 84,909,781 L176P probably damaging Het
Dpp10 T C 1: 123,433,010 D262G probably damaging Het
Dsel T A 1: 111,861,655 E383D probably damaging Het
Flt1 T A 5: 147,639,443 Y585F probably damaging Het
Fubp1 T A 3: 152,220,553 I304N probably damaging Het
Gab2 A G 7: 97,299,130 D309G probably damaging Het
Gon4l T C 3: 88,854,779 V291A probably damaging Het
Gpam C T 19: 55,081,631 V398M possibly damaging Het
Grin3b C T 10: 79,974,588 R643C probably damaging Het
Hdac3 T A 18: 37,941,422 H339L possibly damaging Het
Hsdl2 A T 4: 59,610,621 Q326L unknown Het
Insr T C 8: 3,165,514 probably benign Het
Ivl T A 3: 92,572,636 T41S probably benign Het
Lama4 C T 10: 39,026,707 P226S possibly damaging Het
Lpin1 A G 12: 16,563,620 probably null Het
Lrrc42 A T 4: 107,247,524 N81K probably damaging Het
Mast4 A T 13: 102,761,392 H838Q probably damaging Het
Mcmdc2 A G 1: 9,920,581 M314V possibly damaging Het
Me3 A G 7: 89,739,878 E130G probably damaging Het
Mpnd A G 17: 56,009,405 D28G possibly damaging Het
Mtch2 G T 2: 90,852,864 E102* probably null Het
Myh13 A T 11: 67,363,185 probably null Het
Olfr1117-ps1 G A 2: 87,284,634 V115I probably benign Het
Olfr291 C A 7: 84,857,289 H309N probably benign Het
Plch2 T A 4: 154,989,735 D891V probably damaging Het
Ppfibp2 T C 7: 107,728,750 probably null Het
Rag1 A G 2: 101,642,664 L711P probably damaging Het
Sacs T A 14: 61,213,187 Y4227* probably null Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sema3a T C 5: 13,473,520 probably null Het
Serpina10 C T 12: 103,628,304 G219R probably damaging Het
Sp1 C T 15: 102,409,683 L546F probably benign Het
Syne1 T C 10: 5,123,057 N1256S probably benign Het
Tbc1d5 G T 17: 50,782,427 probably benign Het
Tcrg-V3 A G 13: 19,242,866 T8A probably benign Het
Tns1 T C 1: 73,925,606 S33G probably benign Het
Tpsab1 A G 17: 25,345,471 L3P possibly damaging Het
Vav2 A T 2: 27,269,038 probably benign Het
Vmn1r44 T C 6: 89,893,628 S119P possibly damaging Het
Vmn2r31 A G 7: 7,384,700 L624P probably damaging Het
Vps33a A T 5: 123,533,881 W475R possibly damaging Het
Xpnpep3 G T 15: 81,427,594 R167L possibly damaging Het
Zfhx4 T A 3: 5,398,858 S1384T probably damaging Het
Zfp3 G A 11: 70,772,558 E448K probably benign Het
Zfp362 T A 4: 128,785,976 H299L probably damaging Het
Zfp664 C T 5: 124,885,763 L74F possibly damaging Het
Zfp808 A G 13: 62,172,112 Y385C probably damaging Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78370091 missense probably damaging 1.00
IGL01090:Crim1 APN 17 78347229 missense probably damaging 0.97
IGL01490:Crim1 APN 17 78335296 missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78344434 missense probably benign 0.09
IGL01769:Crim1 APN 17 78313235 missense probably benign 0.02
IGL02004:Crim1 APN 17 78372575 splice site probably benign
IGL02211:Crim1 APN 17 78355145 missense probably damaging 1.00
IGL02275:Crim1 APN 17 78369998 missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78315654 missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78335334 nonsense probably null
IGL02453:Crim1 APN 17 78344484 missense probably damaging 1.00
IGL02481:Crim1 APN 17 78350798 missense probably damaging 0.98
IGL02632:Crim1 APN 17 78372674 missense probably benign 0.08
IGL02652:Crim1 APN 17 78315677 missense probably damaging 1.00
IGL02696:Crim1 APN 17 78279973 missense probably damaging 0.96
IGL02811:Crim1 APN 17 78350701 missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78315750 splice site probably benign
IGL03349:Crim1 APN 17 78355150 nonsense probably null
bugeye UTSW 17 78281347 missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78367798 missense probably benign 0.00
R0227:Crim1 UTSW 17 78344509 splice site probably benign
R0458:Crim1 UTSW 17 78313226 missense probably damaging 0.98
R0482:Crim1 UTSW 17 78372579 missense probably benign 0.00
R0989:Crim1 UTSW 17 78200944 missense probably benign 0.21
R1266:Crim1 UTSW 17 78200833 small deletion probably benign
R1529:Crim1 UTSW 17 78367954 missense probably benign
R1679:Crim1 UTSW 17 78200799 missense probably benign 0.27
R1909:Crim1 UTSW 17 78313127 missense probably benign 0.26
R2273:Crim1 UTSW 17 78355179 critical splice donor site probably null
R3899:Crim1 UTSW 17 78281354 missense probably benign 0.00
R3909:Crim1 UTSW 17 78281239 splice site probably benign
R4092:Crim1 UTSW 17 78350836 missense probably damaging 1.00
R4154:Crim1 UTSW 17 78237843 missense probably benign 0.01
R4687:Crim1 UTSW 17 78303025 missense probably damaging 1.00
R5022:Crim1 UTSW 17 78280129 missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78281347 missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78374090 missense probably damaging 1.00
R5284:Crim1 UTSW 17 78313266 missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78237807 missense probably damaging 1.00
R5635:Crim1 UTSW 17 78315641 missense probably damaging 1.00
R5686:Crim1 UTSW 17 78374083 missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78315717 missense probably damaging 1.00
R6117:Crim1 UTSW 17 78303088 missense probably damaging 1.00
R6129:Crim1 UTSW 17 78281309 missense probably benign 0.17
R6265:Crim1 UTSW 17 78370085 missense probably benign 0.01
R6812:Crim1 UTSW 17 78315600 missense probably damaging 1.00
R6858:Crim1 UTSW 17 78315627 missense probably damaging 1.00
R7920:Crim1 UTSW 17 78303064 missense probably damaging 1.00
R8022:Crim1 UTSW 17 78315555 missense possibly damaging 0.82
R8782:Crim1 UTSW 17 78200877 missense probably damaging 1.00
R8961:Crim1 UTSW 17 78372688 missense possibly damaging 0.65
R8971:Crim1 UTSW 17 78345980 missense possibly damaging 0.89
R9245:Crim1 UTSW 17 78344442 missense probably damaging 1.00
R9250:Crim1 UTSW 17 78370042 missense probably benign
R9401:Crim1 UTSW 17 78350865 frame shift probably null
R9402:Crim1 UTSW 17 78350865 frame shift probably null
R9644:Crim1 UTSW 17 78280068 missense probably damaging 1.00
R9702:Crim1 UTSW 17 78374087 missense probably damaging 1.00
R9710:Crim1 UTSW 17 78303075 nonsense probably null
X0064:Crim1 UTSW 17 78200833 small deletion probably benign
Z1088:Crim1 UTSW 17 78367835 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTCTCCTGTGCCAAAACTGC -3'
(R):5'- TTTGGCTAATCGTTCACCGTAG -3'

Sequencing Primer
(F):5'- GTGCCAAAACTGCTTCTTTACCAGG -3'
(R):5'- ACCGTAGCCTGTTCAGTCTGTG -3'
Posted On 2020-10-20