Incidental Mutation 'R8435:Zdhhc21'
ID653940
Institutional Source Beutler Lab
Gene Symbol Zdhhc21
Ensembl Gene ENSMUSG00000028403
Gene Namezinc finger, DHHC domain containing 21
Synonyms9130404H11Rik, D130004H04Rik, dep
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8435 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location82798738-82859958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82835477 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 158 (Y158C)
Ref Sequence ENSEMBL: ENSMUSP00000030110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030110] [ENSMUST00000107239] [ENSMUST00000139401] [ENSMUST00000173741]
Predicted Effect probably damaging
Transcript: ENSMUST00000030110
AA Change: Y158C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030110
Gene: ENSMUSG00000028403
AA Change: Y158C

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
Pfam:zf-DHHC 61 217 5.6e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107239
AA Change: Y158C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102859
Gene: ENSMUSG00000028403
AA Change: Y158C

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 45 65 N/A INTRINSIC
Pfam:zf-DHHC 85 218 3.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139401
SMART Domains Protein: ENSMUSP00000121954
Gene: ENSMUSG00000028403

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
Pfam:zf-DHHC 61 110 3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173741
SMART Domains Protein: ENSMUSP00000133630
Gene: ENSMUSG00000028403

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
Pfam:zf-DHHC 61 125 1.5e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants of this epidermal acting gene have thin, short hair, many misshapen and disoriented hair follicles, and clumps of pigment reflecting remains of degenerating follicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624G23Rik G T 12: 24,096,880 T30K possibly damaging Het
Adam20 C T 8: 40,795,035 P61S probably damaging Het
Akip1 C T 7: 109,704,986 S90L unknown Het
Atp13a5 C T 16: 29,280,929 probably null Het
Atp1a1 A G 3: 101,582,762 Y684H probably benign Het
Bach2 T A 4: 32,501,682 C20S possibly damaging Het
BC003331 T G 1: 150,382,269 K205T possibly damaging Het
Cage1 T C 13: 38,019,185 I634M possibly damaging Het
Cckbr T C 7: 105,426,073 S17P probably benign Het
Celsr2 T C 3: 108,414,399 T366A probably benign Het
Cps1 G A 1: 67,212,430 V1196I probably benign Het
Ddc A T 11: 11,864,902 S188T probably damaging Het
Eml4 T C 17: 83,421,641 C82R possibly damaging Het
Fig4 T A 10: 41,285,674 H31L probably benign Het
Fkbp5 T C 17: 28,402,778 D366G possibly damaging Het
Ift80 A G 3: 68,985,454 S134P probably damaging Het
Lacc1 A T 14: 77,035,035 V107D possibly damaging Het
Lcp2 A G 11: 34,054,316 E51G probably damaging Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lrp1 A G 10: 127,556,330 Y2815H probably damaging Het
Lrp4 T C 2: 91,477,653 L481P probably damaging Het
Ltbp4 C A 7: 27,335,445 R97L unknown Het
Mbnl1 G A 3: 60,529,669 W13* probably null Het
Neb T A 2: 52,267,717 T2293S probably benign Het
Nrg3 CCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGC 14: 39,472,697 probably benign Het
Olfr110 A G 17: 37,498,785 I45V probably benign Het
Olfr160 T A 9: 37,711,550 H243L probably damaging Het
Olfr657 A T 7: 104,636,450 T259S probably benign Het
Pcmt1 G A 10: 7,640,061 P221L possibly damaging Het
Plag1 T A 4: 3,905,648 D14V probably benign Het
Ppp4r3a A G 12: 101,082,789 S28P probably benign Het
Rab11fip5 T A 6: 85,337,540 I1232F possibly damaging Het
Rpl18a C T 8: 70,895,697 G114D possibly damaging Het
Rtel1 A G 2: 181,354,104 D927G possibly damaging Het
Shcbp1 C T 8: 4,748,734 C395Y probably benign Het
Slc22a28 T A 19: 8,071,200 T361S probably benign Het
Slc35f5 C T 1: 125,561,257 R5* probably null Het
Slc37a4 G A 9: 44,399,462 C121Y probably damaging Het
Sorcs3 C T 19: 48,206,474 R99W possibly damaging Het
Tc2n C T 12: 101,649,117 W483* probably null Het
Tex101 G A 7: 24,668,366 T187I probably damaging Het
Trpc6 T C 9: 8,610,440 L303P probably damaging Het
Trpv5 A T 6: 41,670,893 Y329N probably damaging Het
Tshz1 C A 18: 84,014,024 S753I probably damaging Het
Ttn G A 2: 76,715,920 T32383I probably damaging Het
Txlnb A G 10: 17,827,796 E234G probably damaging Het
Vmn1r120 T A 7: 21,053,632 R51S probably benign Het
Vmn2r17 A T 5: 109,428,306 T348S probably benign Het
Zfp236 C T 18: 82,640,241 G632D probably damaging Het
Other mutations in Zdhhc21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Zdhhc21 APN 4 82844190 missense probably benign 0.43
IGL03172:Zdhhc21 APN 4 82806327 utr 3 prime probably benign
R4393:Zdhhc21 UTSW 4 82847654 missense possibly damaging 0.90
R4701:Zdhhc21 UTSW 4 82820334 missense possibly damaging 0.92
R4910:Zdhhc21 UTSW 4 82820331 missense possibly damaging 0.68
R5288:Zdhhc21 UTSW 4 82847692 missense probably damaging 1.00
R5339:Zdhhc21 UTSW 4 82838313 missense probably damaging 1.00
R6363:Zdhhc21 UTSW 4 82847674 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGCAACAGAGCGCTCTC -3'
(R):5'- CTAGCTGGCCTCCTTGGTAAAG -3'

Sequencing Primer
(F):5'- AACAGAGCGCTCTCTCGAG -3'
(R):5'- AGGTGAGACTTACCTTCATGATCCTG -3'
Posted On2020-10-20