Incidental Mutation 'R8435:Vmn1r120'
ID653945
Institutional Source Beutler Lab
Gene Symbol Vmn1r120
Ensembl Gene ENSMUSG00000093986
Gene Namevomeronasal 1 receptor 120
SynonymsGm5730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8435 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location21052867-21053784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21053632 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 51 (R51S)
Ref Sequence ENSEMBL: ENSMUSP00000100837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105202]
Predicted Effect probably benign
Transcript: ENSMUST00000105202
AA Change: R51S

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100837
Gene: ENSMUSG00000093986
AA Change: R51S

DomainStartEndE-ValueType
Pfam:TAS2R 8 297 2.3e-15 PFAM
Pfam:7tm_1 31 286 3.6e-6 PFAM
Pfam:V1R 41 296 6.4e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624G23Rik G T 12: 24,096,880 T30K possibly damaging Het
Adam20 C T 8: 40,795,035 P61S probably damaging Het
Akip1 C T 7: 109,704,986 S90L unknown Het
Atp13a5 C T 16: 29,280,929 probably null Het
Atp1a1 A G 3: 101,582,762 Y684H probably benign Het
Bach2 T A 4: 32,501,682 C20S possibly damaging Het
BC003331 T G 1: 150,382,269 K205T possibly damaging Het
Cage1 T C 13: 38,019,185 I634M possibly damaging Het
Cckbr T C 7: 105,426,073 S17P probably benign Het
Celsr2 T C 3: 108,414,399 T366A probably benign Het
Cps1 G A 1: 67,212,430 V1196I probably benign Het
Ddc A T 11: 11,864,902 S188T probably damaging Het
Eml4 T C 17: 83,421,641 C82R possibly damaging Het
Fig4 T A 10: 41,285,674 H31L probably benign Het
Fkbp5 T C 17: 28,402,778 D366G possibly damaging Het
Ift80 A G 3: 68,985,454 S134P probably damaging Het
Lacc1 A T 14: 77,035,035 V107D possibly damaging Het
Lcp2 A G 11: 34,054,316 E51G probably damaging Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lrp1 A G 10: 127,556,330 Y2815H probably damaging Het
Lrp4 T C 2: 91,477,653 L481P probably damaging Het
Ltbp4 C A 7: 27,335,445 R97L unknown Het
Mbnl1 G A 3: 60,529,669 W13* probably null Het
Neb T A 2: 52,267,717 T2293S probably benign Het
Nrg3 CCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGC 14: 39,472,697 probably benign Het
Olfr110 A G 17: 37,498,785 I45V probably benign Het
Olfr160 T A 9: 37,711,550 H243L probably damaging Het
Olfr657 A T 7: 104,636,450 T259S probably benign Het
Pcmt1 G A 10: 7,640,061 P221L possibly damaging Het
Plag1 T A 4: 3,905,648 D14V probably benign Het
Ppp4r3a A G 12: 101,082,789 S28P probably benign Het
Rab11fip5 T A 6: 85,337,540 I1232F possibly damaging Het
Rpl18a C T 8: 70,895,697 G114D possibly damaging Het
Rtel1 A G 2: 181,354,104 D927G possibly damaging Het
Shcbp1 C T 8: 4,748,734 C395Y probably benign Het
Slc22a28 T A 19: 8,071,200 T361S probably benign Het
Slc35f5 C T 1: 125,561,257 R5* probably null Het
Slc37a4 G A 9: 44,399,462 C121Y probably damaging Het
Sorcs3 C T 19: 48,206,474 R99W possibly damaging Het
Tc2n C T 12: 101,649,117 W483* probably null Het
Tex101 G A 7: 24,668,366 T187I probably damaging Het
Trpc6 T C 9: 8,610,440 L303P probably damaging Het
Trpv5 A T 6: 41,670,893 Y329N probably damaging Het
Tshz1 C A 18: 84,014,024 S753I probably damaging Het
Ttn G A 2: 76,715,920 T32383I probably damaging Het
Txlnb A G 10: 17,827,796 E234G probably damaging Het
Vmn2r17 A T 5: 109,428,306 T348S probably benign Het
Zdhhc21 T C 4: 82,835,477 Y158C probably damaging Het
Zfp236 C T 18: 82,640,241 G632D probably damaging Het
Other mutations in Vmn1r120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Vmn1r120 APN 7 21053010 missense probably benign 0.00
IGL02533:Vmn1r120 APN 7 21053138 missense probably damaging 1.00
IGL03261:Vmn1r120 APN 7 21053525 missense probably damaging 1.00
R0539:Vmn1r120 UTSW 7 21053472 missense probably damaging 0.99
R0973:Vmn1r120 UTSW 7 21053016 missense probably damaging 1.00
R1831:Vmn1r120 UTSW 7 21053631 missense probably benign
R2034:Vmn1r120 UTSW 7 21052958 missense possibly damaging 0.56
R2149:Vmn1r120 UTSW 7 21052964 missense probably damaging 0.98
R3437:Vmn1r120 UTSW 7 21053657 missense probably damaging 1.00
R5449:Vmn1r120 UTSW 7 21053149 missense possibly damaging 0.53
R5548:Vmn1r120 UTSW 7 21053557 missense probably benign 0.01
R5730:Vmn1r120 UTSW 7 21053009 missense possibly damaging 0.80
R6305:Vmn1r120 UTSW 7 21053606 missense possibly damaging 0.95
R7348:Vmn1r120 UTSW 7 21053452 missense probably damaging 1.00
R8486:Vmn1r120 UTSW 7 21053102 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGGACACTAGCTCTGAGTATAAG -3'
(R):5'- GGTCCTGTAAAACCCTCTCAATG -3'

Sequencing Primer
(F):5'- ACACTAGCTCTGAGTATAAGTTTACC -3'
(R):5'- CAATGTCTGATCATGCTAAATCCCTG -3'
Posted On2020-10-20