Mutagenetix > Incidental Mutation

Incidental Mutation 'R0357:Gadd45gip1'

65395

Institutional Source

Beutler Lab

Gene Symbol

Gadd45gip1

Ensembl Gene

ENSMUSG00000033751

Gene Name

growth arrest and DNA-damage-inducible, gamma interacting protein 1

Synonyms

Crif1, 2310040G17Rik

MMRRC Submission

038563-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0357 (G1)

Quality Score

116

Status

Validated

Chromosome

Chromosomal Location

84831522-84835482 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 84834133 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 126 (A126T)

Ref Sequence

ENSEMBL: ENSMUSP00000037783 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003911] [ENSMUST00000036734] [ENSMUST00000109761] [ENSMUST00000128035]

AlphaFold

Q9CR59

Predicted Effect

probably benign
Transcript: ENSMUST00000003911

SMART Domains

Protein: ENSMUSP00000003911
Gene: ENSMUSG00000003813

Domain	Start	End	E-Value	Type
UBQ	3	77	3.28e-23	SMART
low complexity region	123	151	N/A	INTRINSIC
UBA	163	200	8.76e-11	SMART
STI1	229	272	5.7e-8	SMART
low complexity region	296	307	N/A	INTRINSIC
UBA	319	356	9.11e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000036734
AA Change: A126T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000037783
Gene: ENSMUSG00000033751
AA Change: A126T

Domain	Start	End	E-Value	Type
Pfam:CR6_interact	1	211	1.5e-79	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109761

SMART Domains

Protein: ENSMUSP00000105383
Gene: ENSMUSG00000003813

Domain	Start	End	E-Value	Type
UBQ	3	77	3.28e-23	SMART
low complexity region	123	151	N/A	INTRINSIC
UBA	163	200	8.76e-11	SMART
STI1	230	273	5.7e-8	SMART
low complexity region	297	308	N/A	INTRINSIC
UBA	320	357	9.11e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125711

Predicted Effect

probably benign
Transcript: ENSMUST00000128035

SMART Domains

Protein: ENSMUSP00000115664
Gene: ENSMUSG00000003813

Domain	Start	End	E-Value	Type
UBQ	3	77	3.28e-23	SMART
low complexity region	123	151	N/A	INTRINSIC
UBA	163	200	8.76e-11	SMART
STI1	230	273	5.7e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134395

Predicted Effect

probably benign
Transcript: ENSMUST00000144675

SMART Domains

Protein: ENSMUSP00000114431
Gene: ENSMUSG00000003813

Domain	Start	End	E-Value	Type
SCOP:d1ifya_	2	18	3e-3	SMART
STI1	44	87	5.7e-8	SMART
low complexity region	111	122	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144994

Meta Mutation Damage Score

0.3941

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.3%
20x: 89.3%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-localized protein that may be induced by p53 and regulates the cell cycle by inhibiting G1 to S phase progression. The encoded protein may interact with other cell cycle regulators. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before somite formation with decreased cell proliferation, increased apoptisis, and failure of inner cell mass outgrowth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,179,209	S169P	possibly damaging	Het
4930402H24Rik	A	T	2: 130,712,946		probably benign	Het
4931428F04Rik	A	T	8: 105,285,067	V222E	probably damaging	Het
4932431P20Rik	A	T	7: 29,535,582		noncoding transcript	Het
9230019H11Rik	A	T	10: 3,120,307		noncoding transcript	Het
9230019H11Rik	A	G	10: 3,125,788		noncoding transcript	Het
Abcf2	T	C	5: 24,573,465	K232E	probably benign	Het
AI837181	C	T	19: 5,426,703	T298I	possibly damaging	Het
Alox12	T	C	11: 70,242,536	Y614C	probably damaging	Het
Amn	A	T	12: 111,274,141		probably null	Het
Ankrd33b	A	G	15: 31,305,126	S121P	probably benign	Het
Aox1	A	G	1: 58,092,516	Y1028C	probably damaging	Het
Asph	C	A	4: 9,453,314	R736L	probably benign	Het
Atp2a3	G	A	11: 72,970,931		probably null	Het
Cables2	T	C	2: 180,262,232		probably benign	Het
Catsperg2	A	T	7: 29,714,901	Y360N	possibly damaging	Het
Ccdc129	T	A	6: 55,968,034	M580K	probably benign	Het
Cd163l1	T	G	7: 140,227,895	C660G	probably damaging	Het
Cdh4	T	C	2: 179,847,340	S282P	probably damaging	Het
Col5a3	C	T	9: 20,807,768		probably benign	Het
Ctso	A	T	3: 81,951,543		probably benign	Het
Cyp4f13	A	T	17: 32,932,651	Y125*	probably null	Het
Dapk1	T	A	13: 60,729,558	L537*	probably null	Het
Ddit4l	G	A	3: 137,626,185	R104Q	probably benign	Het
Def6	C	T	17: 28,223,935	H322Y	probably damaging	Het
Dnah6	T	C	6: 73,188,359	N588D	probably benign	Het
Dzip1	T	A	14: 118,909,538	I320F	probably damaging	Het
Epb41l5	T	C	1: 119,609,204	H319R	probably damaging	Het
Erc2	A	G	14: 27,777,022	E285G	probably damaging	Het
Fam109b	C	T	15: 82,343,316	A12V	probably damaging	Het
Fat4	G	A	3: 38,891,227	G1423E	probably damaging	Het
Foxp2	C	T	6: 15,409,840	P480S	probably damaging	Het
Gbp5	G	A	3: 142,505,411	D301N	probably benign	Het
Gm10360	T	C	6: 70,424,313		noncoding transcript	Het
Gm6471	T	A	7: 142,833,867		noncoding transcript	Het
Gm8674	T	A	13: 49,902,113		noncoding transcript	Het
Hist2h2bb	A	C	3: 96,269,788	K13Q	probably null	Het
Ift172	A	G	5: 31,257,900	S1322P	possibly damaging	Het
Ift80	A	T	3: 68,914,653	Y686*	probably null	Het
Insrr	A	C	3: 87,808,646		probably null	Het
Krt83	C	T	15: 101,487,019	V399M	probably benign	Het
Macf1	T	C	4: 123,457,983	N3708S	probably damaging	Het
Mogat1	T	C	1: 78,512,040	S27P	probably benign	Het
Mrgpra4	A	T	7: 47,981,826	M9K	probably benign	Het
Mtus1	A	T	8: 41,083,526	S384R	possibly damaging	Het
Myo1a	T	A	10: 127,710,902	M306K	probably benign	Het
Noxa1	G	T	2: 25,085,850	D403E	probably damaging	Het
Ogdhl	T	C	14: 32,346,458	V884A	possibly damaging	Het
Olfr1335	A	C	4: 118,809,417	L149R	probably damaging	Het
Olfr1392	A	G	11: 49,293,786	N155S	probably damaging	Het
Olfr424	T	A	1: 174,137,299	L185*	probably null	Het
Olfr429	T	C	1: 174,089,109	V23A	possibly damaging	Het
Paxip1	G	A	5: 27,758,623		probably benign	Het
Paxx	T	A	2: 25,460,067	E145D	probably damaging	Het
Pde4d	T	C	13: 109,951,268	V560A	possibly damaging	Het
Plxnd1	C	T	6: 115,969,460	V847M	probably benign	Het
Polk	T	A	13: 96,504,597	M151L	probably damaging	Het
Ptprq	C	T	10: 107,686,199		probably benign	Het
Pum2	A	G	12: 8,721,785	Q371R	possibly damaging	Het
Reln	G	A	5: 21,950,822	A2224V	probably damaging	Het
Shroom1	A	G	11: 53,465,208	T362A	probably damaging	Het
Smarcd2	A	G	11: 106,267,332		probably null	Het
Spg11	A	C	2: 122,066,232		probably benign	Het
Tcaf3	T	A	6: 42,589,827	Y776F	probably damaging	Het
Thada	A	G	17: 84,230,936	V1548A	probably damaging	Het
Trpv2	C	T	11: 62,590,304	P410S	probably damaging	Het
Ube2u	G	T	4: 100,481,654	E39*	probably null	Het
Vmn2r2	C	T	3: 64,133,899		probably null	Het
Vmn2r24	TCC	TC	6: 123,815,410		probably null	Het
Zfp110	A	G	7: 12,836,375	Y43C	probably damaging	Het
Zfp605	A	G	5: 110,124,379	T55A	probably benign	Het

Other mutations in Gadd45gip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0317:Gadd45gip1	UTSW	8	84834116	missense	probably benign
R1739:Gadd45gip1	UTSW	8	84832292	start codon destroyed	probably null	0.71
R7685:Gadd45gip1	UTSW	8	84832351	missense	probably damaging	0.99
R8876:Gadd45gip1	UTSW	8	84834119	missense	probably damaging	1.00
R9198:Gadd45gip1	UTSW	8	84834151	missense	probably damaging	1.00
R9199:Gadd45gip1	UTSW	8	84832499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAATTTGGACCTGGCGTACAAGC -3'
(R):5'- AGCAGCAATTCGTGCCTCCTTC -3'

Sequencing Primer
(F):5'- CGTACAAGCATGTGGAATCACTG -3'
(R):5'- TTGCTGCTTGTCTAGGTCC -3'

Posted On

2013-08-08