Incidental Mutation 'R8435:Shcbp1'
ID653951
Institutional Source Beutler Lab
Gene Symbol Shcbp1
Ensembl Gene ENSMUSG00000022322
Gene NameShc SH2-domain binding protein 1
SynonymsmPAL
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8435 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location4735976-4779567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4748734 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 395 (C395Y)
Ref Sequence ENSEMBL: ENSMUSP00000022945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022945]
Predicted Effect probably benign
Transcript: ENSMUST00000022945
AA Change: C395Y

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022945
Gene: ENSMUSG00000022322
AA Change: C395Y

DomainStartEndE-ValueType
low complexity region 210 219 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
PbH1 428 451 8.61e3 SMART
PbH1 452 473 2.38e3 SMART
PbH1 474 496 9.62e2 SMART
PbH1 497 518 1.07e2 SMART
PbH1 526 548 1.74e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207262
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal viability, fertility and T cell development but show decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624G23Rik G T 12: 24,096,880 T30K possibly damaging Het
Adam20 C T 8: 40,795,035 P61S probably damaging Het
Akip1 C T 7: 109,704,986 S90L unknown Het
Atp13a5 C T 16: 29,280,929 probably null Het
Atp1a1 A G 3: 101,582,762 Y684H probably benign Het
Bach2 T A 4: 32,501,682 C20S possibly damaging Het
BC003331 T G 1: 150,382,269 K205T possibly damaging Het
Cage1 T C 13: 38,019,185 I634M possibly damaging Het
Cckbr T C 7: 105,426,073 S17P probably benign Het
Celsr2 T C 3: 108,414,399 T366A probably benign Het
Cps1 G A 1: 67,212,430 V1196I probably benign Het
Ddc A T 11: 11,864,902 S188T probably damaging Het
Eml4 T C 17: 83,421,641 C82R possibly damaging Het
Fig4 T A 10: 41,285,674 H31L probably benign Het
Fkbp5 T C 17: 28,402,778 D366G possibly damaging Het
Ift80 A G 3: 68,985,454 S134P probably damaging Het
Lacc1 A T 14: 77,035,035 V107D possibly damaging Het
Lcp2 A G 11: 34,054,316 E51G probably damaging Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lrp1 A G 10: 127,556,330 Y2815H probably damaging Het
Lrp4 T C 2: 91,477,653 L481P probably damaging Het
Ltbp4 C A 7: 27,335,445 R97L unknown Het
Mbnl1 G A 3: 60,529,669 W13* probably null Het
Neb T A 2: 52,267,717 T2293S probably benign Het
Nrg3 CCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGC 14: 39,472,697 probably benign Het
Olfr110 A G 17: 37,498,785 I45V probably benign Het
Olfr160 T A 9: 37,711,550 H243L probably damaging Het
Olfr657 A T 7: 104,636,450 T259S probably benign Het
Pcmt1 G A 10: 7,640,061 P221L possibly damaging Het
Plag1 T A 4: 3,905,648 D14V probably benign Het
Ppp4r3a A G 12: 101,082,789 S28P probably benign Het
Rab11fip5 T A 6: 85,337,540 I1232F possibly damaging Het
Rpl18a C T 8: 70,895,697 G114D possibly damaging Het
Rtel1 A G 2: 181,354,104 D927G possibly damaging Het
Slc22a28 T A 19: 8,071,200 T361S probably benign Het
Slc35f5 C T 1: 125,561,257 R5* probably null Het
Slc37a4 G A 9: 44,399,462 C121Y probably damaging Het
Sorcs3 C T 19: 48,206,474 R99W possibly damaging Het
Tc2n C T 12: 101,649,117 W483* probably null Het
Tex101 G A 7: 24,668,366 T187I probably damaging Het
Trpc6 T C 9: 8,610,440 L303P probably damaging Het
Trpv5 A T 6: 41,670,893 Y329N probably damaging Het
Tshz1 C A 18: 84,014,024 S753I probably damaging Het
Ttn G A 2: 76,715,920 T32383I probably damaging Het
Txlnb A G 10: 17,827,796 E234G probably damaging Het
Vmn1r120 T A 7: 21,053,632 R51S probably benign Het
Vmn2r17 A T 5: 109,428,306 T348S probably benign Het
Zdhhc21 T C 4: 82,835,477 Y158C probably damaging Het
Zfp236 C T 18: 82,640,241 G632D probably damaging Het
Other mutations in Shcbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Shcbp1 APN 8 4754258 nonsense probably null
IGL01330:Shcbp1 APN 8 4736372 missense probably benign 0.00
IGL01878:Shcbp1 APN 8 4749721 missense probably damaging 0.98
IGL02415:Shcbp1 APN 8 4754239 missense possibly damaging 0.93
IGL02559:Shcbp1 APN 8 4749305 missense probably damaging 0.98
IGL03171:Shcbp1 APN 8 4739166 missense probably benign 0.05
IGL03348:Shcbp1 APN 8 4765089 missense probably benign 0.10
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0729:Shcbp1 UTSW 8 4736297 missense probably benign 0.05
R0743:Shcbp1 UTSW 8 4764906 missense probably benign
R1413:Shcbp1 UTSW 8 4741968 critical splice acceptor site probably null
R1630:Shcbp1 UTSW 8 4748763 nonsense probably null
R1645:Shcbp1 UTSW 8 4749645 missense probably benign 0.00
R3778:Shcbp1 UTSW 8 4736295 missense probably benign 0.01
R4066:Shcbp1 UTSW 8 4748716 missense probably damaging 0.98
R4232:Shcbp1 UTSW 8 4736372 missense probably benign 0.06
R4524:Shcbp1 UTSW 8 4739193 missense probably damaging 1.00
R4552:Shcbp1 UTSW 8 4749779 nonsense probably null
R4623:Shcbp1 UTSW 8 4739178 missense probably damaging 1.00
R4748:Shcbp1 UTSW 8 4744512 missense probably damaging 1.00
R5093:Shcbp1 UTSW 8 4739214 missense possibly damaging 0.68
R5152:Shcbp1 UTSW 8 4736138 missense probably damaging 1.00
R5540:Shcbp1 UTSW 8 4744529 missense probably damaging 1.00
R5758:Shcbp1 UTSW 8 4749355 splice site probably null
R5878:Shcbp1 UTSW 8 4748742 missense probably benign 0.04
R6062:Shcbp1 UTSW 8 4764905 missense probably benign 0.13
R6366:Shcbp1 UTSW 8 4749380 missense probably damaging 1.00
R6394:Shcbp1 UTSW 8 4736176 missense probably damaging 0.99
R6513:Shcbp1 UTSW 8 4744507 missense probably benign
R6696:Shcbp1 UTSW 8 4739262 missense probably damaging 1.00
R7014:Shcbp1 UTSW 8 4754234 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4741876 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4754310 missense probably damaging 1.00
R7420:Shcbp1 UTSW 8 4748737 missense probably benign 0.02
R7710:Shcbp1 UTSW 8 4764965 missense probably benign 0.14
R7720:Shcbp1 UTSW 8 4748720 missense probably damaging 1.00
R7756:Shcbp1 UTSW 8 4744545 missense probably damaging 0.97
R7769:Shcbp1 UTSW 8 4739232 missense probably damaging 1.00
R7943:Shcbp1 UTSW 8 4748812 missense possibly damaging 0.78
R8114:Shcbp1 UTSW 8 4767930 missense probably damaging 1.00
R8386:Shcbp1 UTSW 8 4767951 missense probably damaging 1.00
X0062:Shcbp1 UTSW 8 4739249 missense probably damaging 0.99
Z1176:Shcbp1 UTSW 8 4765056 missense possibly damaging 0.59
Z1177:Shcbp1 UTSW 8 4736146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGGCACAGGTTGTTG -3'
(R):5'- GTGACAAGCACACAACTGAG -3'

Sequencing Primer
(F):5'- CACAGGTTGTTGAGAAGGTAAACC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2020-10-20