Incidental Mutation 'R8435:Ddc'
ID653961
Institutional Source Beutler Lab
Gene Symbol Ddc
Ensembl Gene ENSMUSG00000020182
Gene Namedopa decarboxylase
SynonymsAadc, aromatic L-amino acid decarboxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8435 (G1)
Quality Score164.009
Status Not validated
Chromosome11
Chromosomal Location11814101-11898144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11864902 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 188 (S188T)
Ref Sequence ENSEMBL: ENSMUSP00000136467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066237] [ENSMUST00000109659] [ENSMUST00000155690] [ENSMUST00000178704]
AlphaFold O88533
Predicted Effect probably damaging
Transcript: ENSMUST00000066237
AA Change: S188T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068525
Gene: ENSMUSG00000020182
AA Change: S188T

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109659
AA Change: S188T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105286
Gene: ENSMUSG00000020182
AA Change: S188T

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 4.8e-174 PFAM
Pfam:Beta_elim_lyase 82 403 4.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155690
AA Change: S188T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121096
Gene: ENSMUSG00000020182
AA Change: S188T

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 253 9.1e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178704
AA Change: S188T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136467
Gene: ENSMUSG00000020182
AA Change: S188T

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. Defects in this gene are the cause of aromatic L-amino-acid decarboxylase deficiency (AADCD). AADCD deficiency is an inborn error in neurotransmitter metabolism that leads to combined serotonin and catecholamine deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit preweaning phenotype. Mice homozygous for a different knock-in allele exhibit partial prenatal lethality, decreased body size, postnatal growth retardation, hypoactivity, increased anxiety, tremors, decreased heart rate and decreased dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624G23Rik G T 12: 24,096,880 T30K possibly damaging Het
Adam20 C T 8: 40,795,035 P61S probably damaging Het
Akip1 C T 7: 109,704,986 S90L unknown Het
Atp13a5 C T 16: 29,280,929 probably null Het
Atp1a1 A G 3: 101,582,762 Y684H probably benign Het
Bach2 T A 4: 32,501,682 C20S possibly damaging Het
BC003331 T G 1: 150,382,269 K205T possibly damaging Het
Cage1 T C 13: 38,019,185 I634M possibly damaging Het
Cckbr T C 7: 105,426,073 S17P probably benign Het
Celsr2 T C 3: 108,414,399 T366A probably benign Het
Cps1 G A 1: 67,212,430 V1196I probably benign Het
Eml4 T C 17: 83,421,641 C82R possibly damaging Het
Fig4 T A 10: 41,285,674 H31L probably benign Het
Fkbp5 T C 17: 28,402,778 D366G possibly damaging Het
Ift80 A G 3: 68,985,454 S134P probably damaging Het
Lacc1 A T 14: 77,035,035 V107D possibly damaging Het
Lcp2 A G 11: 34,054,316 E51G probably damaging Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lrp1 A G 10: 127,556,330 Y2815H probably damaging Het
Lrp4 T C 2: 91,477,653 L481P probably damaging Het
Ltbp4 C A 7: 27,335,445 R97L unknown Het
Mbnl1 G A 3: 60,529,669 W13* probably null Het
Neb T A 2: 52,267,717 T2293S probably benign Het
Nrg3 CCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGC 14: 39,472,697 probably benign Het
Olfr110 A G 17: 37,498,785 I45V probably benign Het
Olfr160 T A 9: 37,711,550 H243L probably damaging Het
Olfr657 A T 7: 104,636,450 T259S probably benign Het
Pcmt1 G A 10: 7,640,061 P221L possibly damaging Het
Plag1 T A 4: 3,905,648 D14V probably benign Het
Ppp4r3a A G 12: 101,082,789 S28P probably benign Het
Rab11fip5 T A 6: 85,337,540 I1232F possibly damaging Het
Rpl18a C T 8: 70,895,697 G114D possibly damaging Het
Rtel1 A G 2: 181,354,104 D927G possibly damaging Het
Shcbp1 C T 8: 4,748,734 C395Y probably benign Het
Slc22a28 T A 19: 8,071,200 T361S probably benign Het
Slc35f5 C T 1: 125,561,257 R5* probably null Het
Slc37a4 G A 9: 44,399,462 C121Y probably damaging Het
Sorcs3 C T 19: 48,206,474 R99W possibly damaging Het
Tc2n C T 12: 101,649,117 W483* probably null Het
Tex101 G A 7: 24,668,366 T187I probably damaging Het
Trpc6 T C 9: 8,610,440 L303P probably damaging Het
Trpv5 A T 6: 41,670,893 Y329N probably damaging Het
Tshz1 C A 18: 84,014,024 S753I probably damaging Het
Ttn G A 2: 76,715,920 T32383I probably damaging Het
Txlnb A G 10: 17,827,796 E234G probably damaging Het
Vmn1r120 T A 7: 21,053,632 R51S probably benign Het
Vmn2r17 A T 5: 109,428,306 T348S probably benign Het
Zdhhc21 T C 4: 82,835,477 Y158C probably damaging Het
Zfp236 C T 18: 82,640,241 G632D probably damaging Het
Other mutations in Ddc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Ddc APN 11 11839462 missense probably damaging 1.00
IGL01336:Ddc APN 11 11846630 splice site probably null
IGL02257:Ddc APN 11 11873171 nonsense probably null
IGL02327:Ddc APN 11 11863739 missense probably damaging 0.98
IGL02516:Ddc APN 11 11829125 missense probably damaging 1.00
IGL02616:Ddc APN 11 11880645 utr 5 prime probably benign
IGL02888:Ddc APN 11 11822297 splice site probably benign
IGL03267:Ddc APN 11 11876303 missense probably damaging 1.00
R0454:Ddc UTSW 11 11880587 missense possibly damaging 0.88
R1061:Ddc UTSW 11 11829132 missense probably benign 0.00
R1173:Ddc UTSW 11 11846634 critical splice donor site probably null
R1382:Ddc UTSW 11 11824856 missense possibly damaging 0.52
R1549:Ddc UTSW 11 11846656 splice site probably null
R1583:Ddc UTSW 11 11829131 missense probably benign 0.17
R1929:Ddc UTSW 11 11835764 missense probably damaging 1.00
R1970:Ddc UTSW 11 11815292 missense possibly damaging 0.87
R2034:Ddc UTSW 11 11880456 missense probably benign 0.40
R2270:Ddc UTSW 11 11835764 missense probably damaging 1.00
R2272:Ddc UTSW 11 11835764 missense probably damaging 1.00
R4449:Ddc UTSW 11 11835802 missense probably damaging 1.00
R4508:Ddc UTSW 11 11819393 critical splice acceptor site probably null
R4799:Ddc UTSW 11 11846632 splice site probably null
R5307:Ddc UTSW 11 11876321 missense probably damaging 1.00
R6654:Ddc UTSW 11 11880452 missense probably damaging 1.00
R6817:Ddc UTSW 11 11824854 missense probably damaging 1.00
R6918:Ddc UTSW 11 11819307 missense probably damaging 1.00
R7001:Ddc UTSW 11 11824870 critical splice acceptor site probably null
R7784:Ddc UTSW 11 11839396 critical splice donor site probably null
R8550:Ddc UTSW 11 11835743 missense probably damaging 1.00
Z1177:Ddc UTSW 11 11880552 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCGGAGGCTCTCAGTATG -3'
(R):5'- TGGGACTTCTTTGCAACATTTC -3'

Sequencing Primer
(F):5'- TAGATCTATCAAGCTCCCACGATAG -3'
(R):5'- GACTTCTTTGCAACATTTCAAATTTC -3'
Posted On2020-10-20