Incidental Mutation 'R8435:Sorcs3'
ID 653976
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Name sortilin-related VPS10 domain containing receptor 3
Synonyms 6330404A12Rik
MMRRC Submission 067824-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R8435 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 48194464-48793944 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 48194913 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 99 (R99W)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
AlphaFold Q8VI51
Predicted Effect possibly damaging
Transcript: ENSMUST00000078880
AA Change: R99W

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: R99W

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624G23Rik G T 12: 24,146,881 (GRCm39) T30K possibly damaging Het
Adam20 C T 8: 41,248,072 (GRCm39) P61S probably damaging Het
Akip1 C T 7: 109,304,193 (GRCm39) S90L unknown Het
Atp13a5 C T 16: 29,099,747 (GRCm39) probably null Het
Atp1a1 A G 3: 101,490,078 (GRCm39) Y684H probably benign Het
Bach2 T A 4: 32,501,682 (GRCm39) C20S possibly damaging Het
Cage1 T C 13: 38,203,161 (GRCm39) I634M possibly damaging Het
Cckbr T C 7: 105,075,280 (GRCm39) S17P probably benign Het
Celsr2 T C 3: 108,321,715 (GRCm39) T366A probably benign Het
Cps1 G A 1: 67,251,589 (GRCm39) V1196I probably benign Het
Ddc A T 11: 11,814,902 (GRCm39) S188T probably damaging Het
Eml4 T C 17: 83,729,070 (GRCm39) C82R possibly damaging Het
Fig4 T A 10: 41,161,670 (GRCm39) H31L probably benign Het
Fkbp5 T C 17: 28,621,752 (GRCm39) D366G possibly damaging Het
Ift80 A G 3: 68,892,787 (GRCm39) S134P probably damaging Het
Lacc1 A T 14: 77,272,475 (GRCm39) V107D possibly damaging Het
Lcp2 A G 11: 34,004,316 (GRCm39) E51G probably damaging Het
Lfng G A 5: 140,598,981 (GRCm39) E297K probably damaging Het
Lrp1 A G 10: 127,392,199 (GRCm39) Y2815H probably damaging Het
Lrp4 T C 2: 91,307,998 (GRCm39) L481P probably damaging Het
Ltbp4 C A 7: 27,034,870 (GRCm39) R97L unknown Het
Mbnl1 G A 3: 60,437,090 (GRCm39) W13* probably null Het
Neb T A 2: 52,157,729 (GRCm39) T2293S probably benign Het
Nrg3 CCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGC 14: 39,194,654 (GRCm39) probably benign Het
Odr4 T G 1: 150,258,020 (GRCm39) K205T possibly damaging Het
Or56b1 A T 7: 104,285,657 (GRCm39) T259S probably benign Het
Or5v1 A G 17: 37,809,676 (GRCm39) I45V probably benign Het
Or8a1b T A 9: 37,622,846 (GRCm39) H243L probably damaging Het
Pcmt1 G A 10: 7,515,825 (GRCm39) P221L possibly damaging Het
Plag1 T A 4: 3,905,648 (GRCm39) D14V probably benign Het
Ppp4r3a A G 12: 101,049,048 (GRCm39) S28P probably benign Het
Rab11fip5 T A 6: 85,314,522 (GRCm39) I1232F possibly damaging Het
Rpl18a C T 8: 71,348,341 (GRCm39) G114D possibly damaging Het
Rtel1 A G 2: 180,995,897 (GRCm39) D927G possibly damaging Het
Shcbp1 C T 8: 4,798,734 (GRCm39) C395Y probably benign Het
Slc22a28 T A 19: 8,048,565 (GRCm39) T361S probably benign Het
Slc35f5 C T 1: 125,488,994 (GRCm39) R5* probably null Het
Slc37a4 G A 9: 44,310,759 (GRCm39) C121Y probably damaging Het
Tc2n C T 12: 101,615,376 (GRCm39) W483* probably null Het
Tex101 G A 7: 24,367,791 (GRCm39) T187I probably damaging Het
Trpc6 T C 9: 8,610,441 (GRCm39) L303P probably damaging Het
Trpv5 A T 6: 41,647,827 (GRCm39) Y329N probably damaging Het
Tshz1 C A 18: 84,032,149 (GRCm39) S753I probably damaging Het
Ttn G A 2: 76,546,264 (GRCm39) T32383I probably damaging Het
Txlnb A G 10: 17,703,544 (GRCm39) E234G probably damaging Het
Vmn1r120 T A 7: 20,787,557 (GRCm39) R51S probably benign Het
Vmn2r17 A T 5: 109,576,172 (GRCm39) T348S probably benign Het
Zdhhc21 T C 4: 82,753,714 (GRCm39) Y158C probably damaging Het
Zfp236 C T 18: 82,658,366 (GRCm39) G632D probably damaging Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48,672,097 (GRCm39) critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48,736,758 (GRCm39) missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48,592,303 (GRCm39) missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48,755,542 (GRCm39) missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48,784,814 (GRCm39) missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48,778,570 (GRCm39) missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48,782,607 (GRCm39) missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48,523,970 (GRCm39) missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48,642,511 (GRCm39) missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48,692,809 (GRCm39) splice site probably benign
IGL02830:Sorcs3 APN 19 48,711,441 (GRCm39) splice site probably null
IGL02943:Sorcs3 APN 19 48,748,377 (GRCm39) missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48,592,333 (GRCm39) missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48,642,483 (GRCm39) missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48,736,758 (GRCm39) missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48,785,956 (GRCm39) critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48,791,137 (GRCm39) nonsense probably null
R0646:Sorcs3 UTSW 19 48,194,734 (GRCm39) missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48,475,845 (GRCm39) missense probably benign
R0792:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48,682,433 (GRCm39) missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48,475,833 (GRCm39) missense probably benign
R1253:Sorcs3 UTSW 19 48,195,175 (GRCm39) missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48,682,440 (GRCm39) critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48,752,620 (GRCm39) missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48,736,798 (GRCm39) critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48,592,314 (GRCm39) missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48,782,713 (GRCm39) missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48,387,150 (GRCm39) missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48,592,343 (GRCm39) missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48,711,395 (GRCm39) missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48,737,812 (GRCm39) missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48,682,353 (GRCm39) missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48,672,036 (GRCm39) missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48,782,602 (GRCm39) missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48,752,587 (GRCm39) missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48,748,390 (GRCm39) missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48,748,284 (GRCm39) critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48,784,911 (GRCm39) splice site probably null
R5848:Sorcs3 UTSW 19 48,776,950 (GRCm39) missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48,737,835 (GRCm39) missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48,784,889 (GRCm39) missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48,387,136 (GRCm39) missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48,748,296 (GRCm39) missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48,778,605 (GRCm39) missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48,791,198 (GRCm39) missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48,752,746 (GRCm39) critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48,776,944 (GRCm39) missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48,702,010 (GRCm39) missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48,682,263 (GRCm39) missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48,737,782 (GRCm39) missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48,694,402 (GRCm39) missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48,760,705 (GRCm39) missense possibly damaging 0.69
R7953:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8043:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8242:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8343:Sorcs3 UTSW 19 48,692,808 (GRCm39) splice site probably null
R8433:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8436:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8940:Sorcs3 UTSW 19 48,784,908 (GRCm39) critical splice donor site probably null
R8956:Sorcs3 UTSW 19 48,737,810 (GRCm39) nonsense probably null
R9051:Sorcs3 UTSW 19 48,194,809 (GRCm39) missense probably benign
R9119:Sorcs3 UTSW 19 48,642,433 (GRCm39) missense possibly damaging 0.92
R9166:Sorcs3 UTSW 19 48,784,811 (GRCm39) missense probably benign 0.01
R9328:Sorcs3 UTSW 19 48,785,950 (GRCm39) missense probably damaging 1.00
R9489:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9605:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9757:Sorcs3 UTSW 19 48,711,363 (GRCm39) missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48,760,728 (GRCm39) missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48,634,243 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48,692,739 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGTCAACATGGGTCCTG -3'
(R):5'- CAGTGCAAAAGACGTGCTG -3'

Sequencing Primer
(F):5'- AGATCACTTGGGGCGCGAC -3'
(R):5'- AACCCTTGGTGTGAGGACG -3'
Posted On 2020-10-20