Incidental Mutation 'R8436:Irs1'
ID653977
Institutional Source Beutler Lab
Gene Symbol Irs1
Ensembl Gene ENSMUSG00000055980
Gene Nameinsulin receptor substrate 1
SynonymsG972R, IRS-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R8436 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location82233101-82291416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82290249 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 82 (H82R)
Ref Sequence ENSEMBL: ENSMUSP00000063795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069799]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069799
AA Change: H82R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: H82R

DomainStartEndE-ValueType
PH 13 117 8.13e-14 SMART
low complexity region 123 143 N/A INTRINSIC
IRS 155 257 1.19e-35 SMART
PTBI 155 257 7.8e-60 SMART
low complexity region 263 276 N/A INTRINSIC
low complexity region 378 399 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
low complexity region 662 689 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 1019 1040 N/A INTRINSIC
low complexity region 1051 1062 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,065,735 I1278V possibly damaging Het
Baz1b A G 5: 135,237,967 H1210R probably damaging Het
Cdt1 C T 8: 122,569,331 S128L probably benign Het
Cfap54 A T 10: 92,964,536 N1603K unknown Het
Cfap99 A G 5: 34,311,682 N300S possibly damaging Het
Chrdl2 G A 7: 100,027,733 probably null Het
Cpb2 C A 14: 75,272,575 F258L probably damaging Het
Csmd3 A T 15: 48,004,822 D767E probably damaging Het
Dennd3 C T 15: 73,562,349 T956I probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Emcn A G 3: 137,423,467 T245A possibly damaging Het
Gm4353 A G 7: 116,083,629 V239A probably damaging Het
Gm4884 G A 7: 41,043,386 A260T probably damaging Het
Hectd4 A G 5: 121,308,358 D205G possibly damaging Het
Hectd4 A G 5: 121,343,147 S3005G probably benign Het
Ifngr1 T C 10: 19,603,805 L148P probably damaging Het
Irf2 C T 8: 46,818,894 T172M probably damaging Het
Kcnc4 G T 3: 107,458,768 N41K probably damaging Het
Lig3 C T 11: 82,792,044 A490V possibly damaging Het
Megf6 G A 4: 154,265,192 E946K probably damaging Het
Mpi A T 9: 57,544,917 Y359N probably damaging Het
Nf1 A G 11: 79,458,883 S1365G probably damaging Het
P3h3 C A 6: 124,851,078 probably null Het
Pdk2 A T 11: 95,039,433 V59D probably damaging Het
Ppip5k2 T C 1: 97,755,888 K168R probably benign Het
Prg4 G T 1: 150,455,567 P452T unknown Het
Prl2b1 T C 13: 27,383,459 N234S possibly damaging Het
Rnd1 T A 15: 98,676,574 T41S possibly damaging Het
Sall4 G A 2: 168,755,910 P337S probably damaging Het
Slc1a2 G A 2: 102,755,953 A301T possibly damaging Het
Sorcs3 C T 19: 48,206,474 R99W possibly damaging Het
Svep1 G A 4: 58,044,053 T3531I possibly damaging Het
Sycp2 T C 2: 178,362,968 D894G probably benign Het
Syne1 T C 10: 5,228,659 N4605S probably benign Het
Syt4 A C 18: 31,440,419 C348G possibly damaging Het
Tceanc2 G A 4: 107,177,581 T28M probably damaging Het
Tmco1 A G 1: 167,308,685 D5G Het
Tnfsf12 T C 11: 69,686,887 K235E probably damaging Het
Trank1 T C 9: 111,391,382 S2396P possibly damaging Het
Vipas39 T A 12: 87,257,417 D125V probably damaging Het
Vmn1r86 A G 7: 13,102,844 F35S probably benign Het
Vmn2r16 A G 5: 109,363,783 N619D probably damaging Het
Vps13a A G 19: 16,740,793 V521A probably benign Het
Wdr20rt T A 12: 65,226,261 L166Q probably damaging Het
Zbtb11 T A 16: 56,000,659 C706* probably null Het
Zscan21 A T 5: 138,117,916 Y30F unknown Het
Other mutations in Irs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Irs1 APN 1 82288483 missense probably benign 0.01
IGL00534:Irs1 APN 1 82288471 missense probably benign
IGL01926:Irs1 APN 1 82289959 missense probably damaging 0.98
IGL02130:Irs1 APN 1 82289467 missense probably damaging 1.00
IGL03338:Irs1 APN 1 82288401 missense probably benign 0.05
Hoverboard UTSW 1 82290098 nonsense probably null
runt UTSW 1 82287732 frame shift probably null
runt2 UTSW 1 82286967 nonsense probably null
R0019:Irs1 UTSW 1 82287256 nonsense probably null
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0318:Irs1 UTSW 1 82288660 missense probably benign 0.01
R1199:Irs1 UTSW 1 82289626 missense probably damaging 1.00
R1363:Irs1 UTSW 1 82287288 missense probably benign 0.02
R1584:Irs1 UTSW 1 82289444 missense probably benign 0.24
R1874:Irs1 UTSW 1 82289853 frame shift probably null
R1903:Irs1 UTSW 1 82289461 missense probably damaging 1.00
R1929:Irs1 UTSW 1 82288459 missense probably benign
R1986:Irs1 UTSW 1 82288765 missense probably damaging 1.00
R2136:Irs1 UTSW 1 82290042 missense probably damaging 1.00
R2179:Irs1 UTSW 1 82290219 missense possibly damaging 0.81
R2271:Irs1 UTSW 1 82288459 missense probably benign
R2760:Irs1 UTSW 1 82288570 missense probably damaging 1.00
R3721:Irs1 UTSW 1 82290085 missense probably benign 0.11
R3821:Irs1 UTSW 1 82290049 missense probably benign
R4306:Irs1 UTSW 1 82287964 missense probably benign 0.11
R4420:Irs1 UTSW 1 82288450 missense possibly damaging 0.94
R4451:Irs1 UTSW 1 82289028 missense probably benign 0.00
R4479:Irs1 UTSW 1 82287294 missense probably damaging 1.00
R4771:Irs1 UTSW 1 82287975 missense probably benign 0.00
R4782:Irs1 UTSW 1 82287463 missense probably benign 0.00
R4836:Irs1 UTSW 1 82287732 frame shift probably null
R4880:Irs1 UTSW 1 82287732 frame shift probably null
R4881:Irs1 UTSW 1 82287732 frame shift probably null
R5031:Irs1 UTSW 1 82286967 nonsense probably null
R5053:Irs1 UTSW 1 82286922 missense probably benign
R5418:Irs1 UTSW 1 82288770 missense probably damaging 1.00
R5595:Irs1 UTSW 1 82289925 missense probably damaging 1.00
R5698:Irs1 UTSW 1 82288734 missense probably benign 0.01
R6381:Irs1 UTSW 1 82287684 missense possibly damaging 0.66
R6563:Irs1 UTSW 1 82288407 missense probably damaging 0.98
R7002:Irs1 UTSW 1 82288260 missense probably benign 0.13
R7095:Irs1 UTSW 1 82290098 nonsense probably null
R7195:Irs1 UTSW 1 82287456 missense probably benign 0.13
R7216:Irs1 UTSW 1 82289755 missense probably damaging 0.98
R7361:Irs1 UTSW 1 82289114 nonsense probably null
R7490:Irs1 UTSW 1 82287264 missense probably damaging 0.99
R7540:Irs1 UTSW 1 82288002 missense not run
R7706:Irs1 UTSW 1 82287691 missense probably damaging 1.00
R7910:Irs1 UTSW 1 82290081 missense probably benign 0.06
R7912:Irs1 UTSW 1 82289884 missense probably benign
R7962:Irs1 UTSW 1 82288722 missense possibly damaging 0.57
R8139:Irs1 UTSW 1 82289739 missense probably damaging 1.00
R8158:Irs1 UTSW 1 82289533 missense probably damaging 1.00
R8159:Irs1 UTSW 1 82288569 missense probably damaging 1.00
R8187:Irs1 UTSW 1 82288300 missense probably damaging 1.00
R8288:Irs1 UTSW 1 82287961 nonsense probably null
X0063:Irs1 UTSW 1 82288908 missense probably damaging 1.00
X0065:Irs1 UTSW 1 82289365 missense probably damaging 1.00
Z1177:Irs1 UTSW 1 82288996 missense possibly damaging 0.87
Z1177:Irs1 UTSW 1 82290394 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TAACCTGCCAGACCTCCTTG -3'
(R):5'- GCCCAAGAGTATGCATAAGCG -3'

Sequencing Primer
(F):5'- GACCCGTGTCATAGCTCAAGTC -3'
(R):5'- CCAAGAGTATGCATAAGCGCTTTTTC -3'
Posted On2020-10-20