Incidental Mutation 'R0388:Dmpk'
ID 65398
Institutional Source Beutler Lab
Gene Symbol Dmpk
Ensembl Gene ENSMUSG00000030409
Gene Name dystrophia myotonica-protein kinase
Synonyms Dm15, DM
MMRRC Submission 038594-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.421) question?
Stock # R0388 (G1)
Quality Score 124
Status Validated
Chromosome 7
Chromosomal Location 18817774-18827746 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 18818002 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000032570] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000108479] [ENSMUST00000122999] [ENSMUST00000154199]
AlphaFold P54265
Predicted Effect unknown
Transcript: ENSMUST00000032568
AA Change: L28H
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409
AA Change: L28H

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032570
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000108473
AA Change: L28H
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409
AA Change: L28H

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000108474
AA Change: L28H
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409
AA Change: L28H

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108479
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000122999
AA Change: L28H
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409
AA Change: L28H

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135839
Predicted Effect unknown
Transcript: ENSMUST00000154199
AA Change: L28H
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409
AA Change: L28H

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142725
Meta Mutation Damage Score 0.0923 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase that contains coiled-coil and C-terminal membrane association domains. In the embryonic mouse, it is found in cardiac and skeletal myocytes where it appears to play a role in myogenesis. In adults, the transcript is localized to several tissues including brain, heart, and skeletal and smooth muscle, and a function in cytoskeletal remodeling has been described. Transcripts with expanded CUG repeats in the 3' untranslated region mediate alternative splicing of several genes and sequester RNA binding proteins and RNA transcripts that contain CAG repeats, resulting in myotonic dystrophy, an autosomal dominant neuromuscular disorder. Alternative splicing results in multiple protein coding and non-coding transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit abnormal sodium channel gating in cardiac myocytes, cardiac conduction defects, and late-onset progressive skeletal myopathy. Homozygotes for a second null mutation do not develop skeletal myopathy but do have abnormal muscle intracellular calcium levels. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,057,789 (GRCm39) probably benign Het
Acsbg1 T C 9: 54,516,347 (GRCm39) K678R probably damaging Het
Adgrg6 A G 10: 14,326,402 (GRCm39) I410T probably benign Het
Afap1l2 A C 19: 56,905,674 (GRCm39) probably benign Het
Aox1 T C 1: 58,393,565 (GRCm39) Y1242H probably damaging Het
Apoo-ps T C 13: 107,551,173 (GRCm39) noncoding transcript Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Cdh3 C A 8: 107,265,761 (GRCm39) T268K probably damaging Het
Chd5 T A 4: 152,456,101 (GRCm39) H923Q probably damaging Het
Chd7 T C 4: 8,854,560 (GRCm39) V1967A probably benign Het
Cntn3 T C 6: 102,254,277 (GRCm39) M222V probably damaging Het
Dcaf17 A G 2: 70,908,915 (GRCm39) K277R probably benign Het
Dmbt1 T C 7: 130,697,779 (GRCm39) probably benign Het
Dzank1 A T 2: 144,318,026 (GRCm39) L714Q possibly damaging Het
Efcab3 A G 11: 105,000,227 (GRCm39) D272G possibly damaging Het
Erbb2 G C 11: 98,318,177 (GRCm39) R471P possibly damaging Het
Esf1 T A 2: 139,962,791 (GRCm39) Y760F possibly damaging Het
Fanci C A 7: 79,089,378 (GRCm39) T938K probably benign Het
Gnai3 A G 3: 108,023,073 (GRCm39) probably benign Het
Hspg2 T A 4: 137,238,469 (GRCm39) C319S probably damaging Het
Il12a T A 3: 68,602,520 (GRCm39) probably null Het
Inpp4a A G 1: 37,435,241 (GRCm39) D837G probably damaging Het
Kcnj5 T A 9: 32,229,159 (GRCm39) E13V probably damaging Het
Kcnq3 T A 15: 65,871,887 (GRCm39) Y594F probably benign Het
Kif16b T C 2: 142,582,857 (GRCm39) E556G probably damaging Het
Kif28 T C 1: 179,567,654 (GRCm39) I39V possibly damaging Het
Lgi2 T C 5: 52,711,891 (GRCm39) E143G probably damaging Het
Mast1 T G 8: 85,642,166 (GRCm39) I1063L probably benign Het
Med12l T C 3: 59,000,925 (GRCm39) probably benign Het
Mmp19 G T 10: 128,634,752 (GRCm39) R456L probably benign Het
Mon1b T A 8: 114,365,710 (GRCm39) V346E probably damaging Het
Mpv17l A T 16: 13,758,863 (GRCm39) I96L probably benign Het
Mrgpra9 A T 7: 46,902,542 (GRCm39) M1K probably null Het
Mycbp2 A T 14: 103,394,103 (GRCm39) H2819Q probably benign Het
Nav1 A C 1: 135,376,655 (GRCm39) probably benign Het
Neurl4 T C 11: 69,802,559 (GRCm39) probably benign Het
Ntng2 G C 2: 29,097,438 (GRCm39) P341R probably damaging Het
Oas1d A T 5: 121,055,091 (GRCm39) Y221F probably damaging Het
Or1j19 C A 2: 36,676,874 (GRCm39) D112E probably benign Het
Or1l4 A C 2: 37,092,196 (GRCm39) probably null Het
Or5al6 A G 2: 85,976,974 (GRCm39) Y35H probably damaging Het
Osbpl8 A G 10: 111,108,143 (GRCm39) M380V probably benign Het
Pank1 T C 19: 34,799,106 (GRCm39) probably benign Het
Parn T C 16: 13,472,340 (GRCm39) D169G possibly damaging Het
Pknox1 T A 17: 31,822,166 (GRCm39) I311N probably damaging Het
Pprc1 T C 19: 46,051,214 (GRCm39) V248A possibly damaging Het
Prkcq T C 2: 11,259,045 (GRCm39) C322R probably benign Het
Ptpn13 T A 5: 103,702,928 (GRCm39) I1298N probably benign Het
Rab11fip3 A G 17: 26,288,046 (GRCm39) S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Sass6 C A 3: 116,400,957 (GRCm39) probably benign Het
Shroom3 G A 5: 93,099,152 (GRCm39) G1463D probably benign Het
Slc35d1 A T 4: 103,042,084 (GRCm39) Y249* probably null Het
Slc9a3 C T 13: 74,269,655 (GRCm39) P8S unknown Het
Slc9a9 T A 9: 94,821,616 (GRCm39) probably null Het
Sting1 A G 18: 35,868,164 (GRCm39) probably null Het
Syne2 T A 12: 76,033,749 (GRCm39) M3666K probably benign Het
Synpo2 A G 3: 122,873,546 (GRCm39) V1140A probably benign Het
Thada A G 17: 84,538,524 (GRCm39) F1495L probably benign Het
Timeless A G 10: 128,077,294 (GRCm39) probably null Het
Tlr6 G T 5: 65,112,548 (GRCm39) H120N possibly damaging Het
Tns3 T C 11: 8,395,703 (GRCm39) I1234V probably benign Het
Ttll9 A G 2: 152,842,099 (GRCm39) S318G probably benign Het
Vps13c T C 9: 67,830,197 (GRCm39) probably benign Het
Zfp933 T C 4: 147,910,899 (GRCm39) I232M probably benign Het
Zfyve27 T C 19: 42,178,024 (GRCm39) S382P probably damaging Het
Other mutations in Dmpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dmpk APN 7 18,822,117 (GRCm39) missense probably damaging 0.98
IGL02874:Dmpk APN 7 18,820,926 (GRCm39) missense possibly damaging 0.75
IGL02942:Dmpk APN 7 18,826,166 (GRCm39) missense probably damaging 0.99
IGL03081:Dmpk APN 7 18,821,458 (GRCm39) missense probably damaging 1.00
IGL03258:Dmpk APN 7 18,826,131 (GRCm39) critical splice acceptor site probably null
IGL03302:Dmpk APN 7 18,820,411 (GRCm39) splice site probably benign
P0008:Dmpk UTSW 7 18,821,987 (GRCm39) missense possibly damaging 0.89
R0961:Dmpk UTSW 7 18,821,195 (GRCm39) missense probably damaging 0.99
R3103:Dmpk UTSW 7 18,821,579 (GRCm39) missense probably damaging 1.00
R3157:Dmpk UTSW 7 18,826,944 (GRCm39) missense probably benign 0.00
R3158:Dmpk UTSW 7 18,826,944 (GRCm39) missense probably benign 0.00
R3159:Dmpk UTSW 7 18,826,944 (GRCm39) missense probably benign 0.00
R3498:Dmpk UTSW 7 18,820,306 (GRCm39) missense probably damaging 1.00
R4696:Dmpk UTSW 7 18,822,139 (GRCm39) missense probably damaging 1.00
R4830:Dmpk UTSW 7 18,821,453 (GRCm39) missense probably damaging 1.00
R4991:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5156:Dmpk UTSW 7 18,818,050 (GRCm39) missense probably damaging 1.00
R5169:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5170:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5171:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5172:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5198:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5200:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5202:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5205:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5383:Dmpk UTSW 7 18,821,944 (GRCm39) missense probably benign 0.05
R5449:Dmpk UTSW 7 18,824,916 (GRCm39) missense probably benign 0.18
R5639:Dmpk UTSW 7 18,826,525 (GRCm39) missense probably benign 0.22
R5874:Dmpk UTSW 7 18,826,007 (GRCm39) intron probably benign
R6939:Dmpk UTSW 7 18,822,149 (GRCm39) missense probably damaging 0.97
R7133:Dmpk UTSW 7 18,821,232 (GRCm39) missense probably damaging 1.00
R7352:Dmpk UTSW 7 18,819,997 (GRCm39) missense probably damaging 0.98
R8032:Dmpk UTSW 7 18,821,978 (GRCm39) missense possibly damaging 0.63
R8234:Dmpk UTSW 7 18,822,048 (GRCm39) missense probably benign 0.00
R8886:Dmpk UTSW 7 18,825,886 (GRCm39) unclassified probably benign
R9052:Dmpk UTSW 7 18,821,614 (GRCm39) missense probably damaging 0.99
R9235:Dmpk UTSW 7 18,822,141 (GRCm39) missense probably damaging 1.00
R9420:Dmpk UTSW 7 18,824,946 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGAATCCATTGCTGAGTCACGAAG -3'
(R):5'- CATAGCCCATTCTTGCCCTGTAGAC -3'

Sequencing Primer
(F):5'- GGGCAACCCTGGAGTATTAC -3'
(R):5'- TGCCCTGTAGACCCACC -3'
Posted On 2013-08-08