Incidental Mutation 'R0388:Dmpk'
ID65398
Institutional Source Beutler Lab
Gene Symbol Dmpk
Ensembl Gene ENSMUSG00000030409
Gene Namedystrophia myotonica-protein kinase
SynonymsDM, Dm15
MMRRC Submission 038594-MU
Accession Numbers

NCBI RefSeq: NM_032418.2, NM_001190490.1, NM_001190491.1; MGI: 94906

Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R0388 (G1)
Quality Score124
Status Validated
Chromosome7
Chromosomal Location19083849-19093821 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 19084077 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000032570] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000108479] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect unknown
Transcript: ENSMUST00000032568
AA Change: L28H
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409
AA Change: L28H

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032570
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000108473
AA Change: L28H
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409
AA Change: L28H

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000108474
AA Change: L28H
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409
AA Change: L28H

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108479
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000122999
AA Change: L28H
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409
AA Change: L28H

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152050
Predicted Effect unknown
Transcript: ENSMUST00000154199
AA Change: L28H
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409
AA Change: L28H

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174918
Meta Mutation Damage Score 0.0923 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype Strain: 3054407; 2182402
FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase that contains coiled-coil and C-terminal membrane association domains. In the embryonic mouse, it is found in cardiac and skeletal myocytes where it appears to play a role in myogenesis. In adults, the transcript is localized to several tissues including brain, heart, and skeletal and smooth muscle, and a function in cytoskeletal remodeling has been described. Transcripts with expanded CUG repeats in the 3' untranslated region mediate alternative splicing of several genes and sequester RNA binding proteins and RNA transcripts that contain CAG repeats, resulting in myotonic dystrophy, an autosomal dominant neuromuscular disorder. Alternative splicing results in multiple protein coding and non-coding transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit abnormal sodium channel gating in cardiac myocytes, cardiac conduction defects, and late-onset progressive skeletal myopathy. Homozygotes for a second null mutation do not develop skeletal myopathy but do have abnormal muscle intracellular calcium levels. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Dmpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dmpk APN 7 19088192 missense probably damaging 0.98
IGL02874:Dmpk APN 7 19087001 missense possibly damaging 0.75
IGL02942:Dmpk APN 7 19092241 missense probably damaging 0.99
IGL03081:Dmpk APN 7 19087533 missense probably damaging 1.00
IGL03258:Dmpk APN 7 19092206 critical splice acceptor site probably null
IGL03302:Dmpk APN 7 19086486 splice site probably benign
P0008:Dmpk UTSW 7 19088062 missense possibly damaging 0.89
R0961:Dmpk UTSW 7 19087270 missense probably damaging 0.99
R3103:Dmpk UTSW 7 19087654 missense probably damaging 1.00
R3157:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3158:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3159:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3498:Dmpk UTSW 7 19086381 missense probably damaging 1.00
R4696:Dmpk UTSW 7 19088214 missense probably damaging 1.00
R4830:Dmpk UTSW 7 19087528 missense probably damaging 1.00
R4991:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5156:Dmpk UTSW 7 19084125 missense probably damaging 1.00
R5169:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5170:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5171:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5172:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5198:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5200:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5202:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5205:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5383:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5449:Dmpk UTSW 7 19090991 missense probably benign 0.18
R5639:Dmpk UTSW 7 19092600 missense probably benign 0.22
R5874:Dmpk UTSW 7 19092082 intron probably benign
R6939:Dmpk UTSW 7 19088224 missense probably damaging 0.97
R7133:Dmpk UTSW 7 19087307 missense probably damaging 1.00
R7352:Dmpk UTSW 7 19086072 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGGAATCCATTGCTGAGTCACGAAG -3'
(R):5'- CATAGCCCATTCTTGCCCTGTAGAC -3'

Sequencing Primer
(F):5'- GGGCAACCCTGGAGTATTAC -3'
(R):5'- TGCCCTGTAGACCCACC -3'
Posted On2013-08-08