Incidental Mutation 'R8436:Tceanc2'
ID653987
Institutional Source Beutler Lab
Gene Symbol Tceanc2
Ensembl Gene ENSMUSG00000028619
Gene Nametranscription elongation factor A (SII) N-terminal and central domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R8436 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location107134155-107179116 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107177581 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 28 (T28M)
Ref Sequence ENSEMBL: ENSMUSP00000059741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030361] [ENSMUST00000030362] [ENSMUST00000057043] [ENSMUST00000058585] [ENSMUST00000106753] [ENSMUST00000127720] [ENSMUST00000128123] [ENSMUST00000141165] [ENSMUST00000154007]
Predicted Effect probably benign
Transcript: ENSMUST00000030361
SMART Domains Protein: ENSMUSP00000030361
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:BSMAP 72 256 1.1e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030362
AA Change: T28M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030362
Gene: ENSMUSG00000028619
AA Change: T28M

DomainStartEndE-ValueType
Pfam:Med26 60 111 7.9e-20 PFAM
Pfam:TFIIS_M 126 207 1.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000057043
AA Change: T28M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059741
Gene: ENSMUSG00000028619
AA Change: T28M

DomainStartEndE-ValueType
Pfam:Med26 60 111 7.9e-20 PFAM
Pfam:TFIIS_M 126 207 1.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058585
AA Change: T28M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054142
Gene: ENSMUSG00000028619
AA Change: T28M

DomainStartEndE-ValueType
Pfam:Med26 61 110 5.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106753
SMART Domains Protein: ENSMUSP00000102364
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
Pfam:BSMAP 32 189 2.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127720
AA Change: T28M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000128123
SMART Domains Protein: ENSMUSP00000120288
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
Pfam:BSMAP 18 127 1.7e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141165
AA Change: T28M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115005
Gene: ENSMUSG00000028619
AA Change: T28M

DomainStartEndE-ValueType
Pfam:Med26 60 111 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154007
SMART Domains Protein: ENSMUSP00000119701
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,065,735 I1278V possibly damaging Het
Baz1b A G 5: 135,237,967 H1210R probably damaging Het
Cdt1 C T 8: 122,569,331 S128L probably benign Het
Cfap54 A T 10: 92,964,536 N1603K unknown Het
Cfap99 A G 5: 34,311,682 N300S possibly damaging Het
Chrdl2 G A 7: 100,027,733 probably null Het
Cpb2 C A 14: 75,272,575 F258L probably damaging Het
Csmd3 A T 15: 48,004,822 D767E probably damaging Het
Dennd3 C T 15: 73,562,349 T956I probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Emcn A G 3: 137,423,467 T245A possibly damaging Het
Gm4353 A G 7: 116,083,629 V239A probably damaging Het
Gm4884 G A 7: 41,043,386 A260T probably damaging Het
Hectd4 A G 5: 121,308,358 D205G possibly damaging Het
Hectd4 A G 5: 121,343,147 S3005G probably benign Het
Ifngr1 T C 10: 19,603,805 L148P probably damaging Het
Irf2 C T 8: 46,818,894 T172M probably damaging Het
Irs1 T C 1: 82,290,249 H82R possibly damaging Het
Kcnc4 G T 3: 107,458,768 N41K probably damaging Het
Lig3 C T 11: 82,792,044 A490V possibly damaging Het
Megf6 G A 4: 154,265,192 E946K probably damaging Het
Mpi A T 9: 57,544,917 Y359N probably damaging Het
Nf1 A G 11: 79,458,883 S1365G probably damaging Het
P3h3 C A 6: 124,851,078 probably null Het
Pdk2 A T 11: 95,039,433 V59D probably damaging Het
Ppip5k2 T C 1: 97,755,888 K168R probably benign Het
Prg4 G T 1: 150,455,567 P452T unknown Het
Prl2b1 T C 13: 27,383,459 N234S possibly damaging Het
Rnd1 T A 15: 98,676,574 T41S possibly damaging Het
Sall4 G A 2: 168,755,910 P337S probably damaging Het
Slc1a2 G A 2: 102,755,953 A301T possibly damaging Het
Sorcs3 C T 19: 48,206,474 R99W possibly damaging Het
Svep1 G A 4: 58,044,053 T3531I possibly damaging Het
Sycp2 T C 2: 178,362,968 D894G probably benign Het
Syne1 T C 10: 5,228,659 N4605S probably benign Het
Syt4 A C 18: 31,440,419 C348G possibly damaging Het
Tmco1 A G 1: 167,308,685 D5G Het
Tnfsf12 T C 11: 69,686,887 K235E probably damaging Het
Trank1 T C 9: 111,391,382 S2396P possibly damaging Het
Vipas39 T A 12: 87,257,417 D125V probably damaging Het
Vmn1r86 A G 7: 13,102,844 F35S probably benign Het
Vmn2r16 A G 5: 109,363,783 N619D probably damaging Het
Vps13a A G 19: 16,740,793 V521A probably benign Het
Wdr20rt T A 12: 65,226,261 L166Q probably damaging Het
Zbtb11 T A 16: 56,000,659 C706* probably null Het
Zscan21 A T 5: 138,117,916 Y30F unknown Het
Other mutations in Tceanc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03102:Tceanc2 APN 4 107147681 missense probably damaging 0.99
R1434:Tceanc2 UTSW 4 107147640 missense probably benign 0.05
R4664:Tceanc2 UTSW 4 107165560 missense probably damaging 1.00
R4666:Tceanc2 UTSW 4 107165560 missense probably damaging 1.00
R5279:Tceanc2 UTSW 4 107177629 splice site probably null
R5490:Tceanc2 UTSW 4 107165649 missense probably benign 0.05
R6057:Tceanc2 UTSW 4 107147579 missense probably damaging 1.00
R7402:Tceanc2 UTSW 4 107147696 missense probably benign 0.06
R7485:Tceanc2 UTSW 4 107165655 missense probably damaging 0.99
R8025:Tceanc2 UTSW 4 107139800 critical splice acceptor site probably null
R8120:Tceanc2 UTSW 4 107177632 missense probably benign
R8249:Tceanc2 UTSW 4 107178993 intron probably benign
Z1176:Tceanc2 UTSW 4 107147688 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGATCCTGTCAGCTAGCAAC -3'
(R):5'- TCTGGGAATACACATCTCAACC -3'

Sequencing Primer
(F):5'- TGATCCTGTCAGCTAGCAACCATAC -3'
(R):5'- CTCAACCTTAATAAAGTTTCACCCTG -3'
Posted On2020-10-20