Incidental Mutation 'R8436:Baz1b'
ID653993
Institutional Source Beutler Lab
Gene Symbol Baz1b
Ensembl Gene ENSMUSG00000002748
Gene Namebromodomain adjacent to zinc finger domain, 1B
SynonymsWSTF, Wbscr9
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8436 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135187264-135246129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135237967 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1210 (H1210R)
Ref Sequence ENSEMBL: ENSMUSP00000002825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002825]
Predicted Effect probably damaging
Transcript: ENSMUST00000002825
AA Change: H1210R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002825
Gene: ENSMUSG00000002748
AA Change: H1210R

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 21 120 2.6e-28 PFAM
low complexity region 312 335 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
coiled coil region 537 587 N/A INTRINSIC
DDT 605 669 5.59e-17 SMART
Pfam:WHIM1 725 773 2.2e-9 PFAM
low complexity region 822 835 N/A INTRINSIC
coiled coil region 854 890 N/A INTRINSIC
Pfam:WHIM2 900 935 1.3e-10 PFAM
Pfam:WHIM3 991 1029 1.5e-16 PFAM
low complexity region 1131 1148 N/A INTRINSIC
PHD 1186 1232 1.89e-14 SMART
RING 1187 1231 7.85e-2 SMART
low complexity region 1245 1277 N/A INTRINSIC
BROMO 1333 1441 3.63e-37 SMART
low complexity region 1459 1472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bromodomain protein family. The bromodomain is a structural motif characteristic of proteins involved in chromatin-dependent regulation of transcription. This gene is deleted in Williams-Beuren syndrome, a developmental disorder caused by deletion of multiple genes at 7q11.23. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality by P2, small size at birth, impaired double strand DNA repair, and heart defects. Mice heterozygous for a null allele exhibit hypercalcemia and heart defects. Mice homozygous for an ENU mutation exhibit craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,065,735 I1278V possibly damaging Het
Cdt1 C T 8: 122,569,331 S128L probably benign Het
Cfap54 A T 10: 92,964,536 N1603K unknown Het
Cfap99 A G 5: 34,311,682 N300S possibly damaging Het
Chrdl2 G A 7: 100,027,733 probably null Het
Cpb2 C A 14: 75,272,575 F258L probably damaging Het
Csmd3 A T 15: 48,004,822 D767E probably damaging Het
Dennd3 C T 15: 73,562,349 T956I probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Emcn A G 3: 137,423,467 T245A possibly damaging Het
Gm4353 A G 7: 116,083,629 V239A probably damaging Het
Gm4884 G A 7: 41,043,386 A260T probably damaging Het
Hectd4 A G 5: 121,308,358 D205G possibly damaging Het
Hectd4 A G 5: 121,343,147 S3005G probably benign Het
Ifngr1 T C 10: 19,603,805 L148P probably damaging Het
Irf2 C T 8: 46,818,894 T172M probably damaging Het
Irs1 T C 1: 82,290,249 H82R possibly damaging Het
Kcnc4 G T 3: 107,458,768 N41K probably damaging Het
Lig3 C T 11: 82,792,044 A490V possibly damaging Het
Megf6 G A 4: 154,265,192 E946K probably damaging Het
Mpi A T 9: 57,544,917 Y359N probably damaging Het
Nf1 A G 11: 79,458,883 S1365G probably damaging Het
P3h3 C A 6: 124,851,078 probably null Het
Pdk2 A T 11: 95,039,433 V59D probably damaging Het
Ppip5k2 T C 1: 97,755,888 K168R probably benign Het
Prg4 G T 1: 150,455,567 P452T unknown Het
Prl2b1 T C 13: 27,383,459 N234S possibly damaging Het
Rnd1 T A 15: 98,676,574 T41S possibly damaging Het
Sall4 G A 2: 168,755,910 P337S probably damaging Het
Slc1a2 G A 2: 102,755,953 A301T possibly damaging Het
Sorcs3 C T 19: 48,206,474 R99W possibly damaging Het
Svep1 G A 4: 58,044,053 T3531I possibly damaging Het
Sycp2 T C 2: 178,362,968 D894G probably benign Het
Syne1 T C 10: 5,228,659 N4605S probably benign Het
Syt4 A C 18: 31,440,419 C348G possibly damaging Het
Tceanc2 G A 4: 107,177,581 T28M probably damaging Het
Tmco1 A G 1: 167,308,685 D5G Het
Tnfsf12 T C 11: 69,686,887 K235E probably damaging Het
Trank1 T C 9: 111,391,382 S2396P possibly damaging Het
Vipas39 T A 12: 87,257,417 D125V probably damaging Het
Vmn1r86 A G 7: 13,102,844 F35S probably benign Het
Vmn2r16 A G 5: 109,363,783 N619D probably damaging Het
Vps13a A G 19: 16,740,793 V521A probably benign Het
Wdr20rt T A 12: 65,226,261 L166Q probably damaging Het
Zbtb11 T A 16: 56,000,659 C706* probably null Het
Zscan21 A T 5: 138,117,916 Y30F unknown Het
Other mutations in Baz1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Baz1b APN 5 135216590 missense probably damaging 0.99
IGL00589:Baz1b APN 5 135196492 missense possibly damaging 0.50
IGL00736:Baz1b APN 5 135240032 missense probably damaging 1.00
IGL02053:Baz1b APN 5 135242466 missense probably benign 0.00
IGL02197:Baz1b APN 5 135209097 missense probably benign 0.20
IGL02236:Baz1b APN 5 135217284 missense probably damaging 1.00
IGL02351:Baz1b APN 5 135244306 missense probably damaging 1.00
IGL02358:Baz1b APN 5 135244306 missense probably damaging 1.00
IGL02424:Baz1b APN 5 135217979 missense probably damaging 1.00
IGL03051:Baz1b APN 5 135217225 missense probably benign 0.02
PIT4480001:Baz1b UTSW 5 135217965 missense probably damaging 1.00
R0097:Baz1b UTSW 5 135198259 missense probably benign 0.11
R0097:Baz1b UTSW 5 135198259 missense probably benign 0.11
R0365:Baz1b UTSW 5 135240131 missense probably benign 0.00
R0655:Baz1b UTSW 5 135242430 missense probably benign 0.00
R0698:Baz1b UTSW 5 135198221 missense probably damaging 1.00
R0959:Baz1b UTSW 5 135244222 missense probably damaging 1.00
R1411:Baz1b UTSW 5 135230323 missense possibly damaging 0.73
R1469:Baz1b UTSW 5 135217979 missense probably damaging 1.00
R1469:Baz1b UTSW 5 135217979 missense probably damaging 1.00
R1511:Baz1b UTSW 5 135217782 missense probably damaging 1.00
R1557:Baz1b UTSW 5 135218243 missense possibly damaging 0.94
R1674:Baz1b UTSW 5 135205111 missense probably damaging 1.00
R1760:Baz1b UTSW 5 135242524 missense probably benign
R1951:Baz1b UTSW 5 135216739 missense probably benign 0.11
R2058:Baz1b UTSW 5 135217225 missense probably benign 0.02
R2060:Baz1b UTSW 5 135205114 missense probably damaging 1.00
R2142:Baz1b UTSW 5 135217275 missense probably damaging 1.00
R2496:Baz1b UTSW 5 135210775 missense probably damaging 1.00
R4088:Baz1b UTSW 5 135216940 missense probably damaging 0.96
R4397:Baz1b UTSW 5 135244446 missense probably damaging 1.00
R4784:Baz1b UTSW 5 135217413 missense possibly damaging 0.51
R4785:Baz1b UTSW 5 135217413 missense possibly damaging 0.51
R5386:Baz1b UTSW 5 135238059 missense probably damaging 1.00
R5653:Baz1b UTSW 5 135209097 missense probably benign 0.20
R5808:Baz1b UTSW 5 135221958 missense probably benign 0.00
R6010:Baz1b UTSW 5 135217451 missense possibly damaging 0.82
R6014:Baz1b UTSW 5 135217394 missense probably damaging 1.00
R6173:Baz1b UTSW 5 135242507 missense probably benign
R6194:Baz1b UTSW 5 135243890 missense probably damaging 0.99
R6419:Baz1b UTSW 5 135242494 missense probably benign
R6435:Baz1b UTSW 5 135237945 missense probably damaging 1.00
R7078:Baz1b UTSW 5 135217439 missense probably benign 0.04
R7341:Baz1b UTSW 5 135223116 missense probably damaging 1.00
R7683:Baz1b UTSW 5 135217728 missense probably damaging 0.97
R7922:Baz1b UTSW 5 135231679 missense probably damaging 0.99
R8188:Baz1b UTSW 5 135205062 missense probably benign 0.12
R8429:Baz1b UTSW 5 135217331 missense probably benign 0.01
R8489:Baz1b UTSW 5 135216855 missense probably damaging 1.00
R8688:Baz1b UTSW 5 135242489 missense probably benign 0.01
R8771:Baz1b UTSW 5 135244297 missense probably benign 0.19
R8832:Baz1b UTSW 5 135217376 missense possibly damaging 0.95
X0027:Baz1b UTSW 5 135216892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGTTCTAGAGGATCCGTG -3'
(R):5'- GCTTTAACTCCTTAGAAACGCTCAG -3'

Sequencing Primer
(F):5'- TGTTGGGCAGCTAGGACTCC -3'
(R):5'- TTTGTAGCCAAGGATGACCC -3'
Posted On2020-10-20