Incidental Mutation 'R8436:Zbtb11'
ID654020
Institutional Source Beutler Lab
Gene Symbol Zbtb11
Ensembl Gene ENSMUSG00000022601
Gene Namezinc finger and BTB domain containing 11
SynonymsZNF-U69274, 9230110G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R8436 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location55973883-56008913 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 56000659 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 706 (C706*)
Ref Sequence ENSEMBL: ENSMUSP00000056923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050248]
Predicted Effect probably null
Transcript: ENSMUST00000050248
AA Change: C706*
SMART Domains Protein: ENSMUSP00000056923
Gene: ENSMUSG00000022601
AA Change: C706*

DomainStartEndE-ValueType
low complexity region 136 158 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
BTB 214 312 4.77e-13 SMART
low complexity region 371 399 N/A INTRINSIC
ZnF_C2H2 566 588 1.1e-2 SMART
ZnF_C2H2 594 616 2.09e-3 SMART
low complexity region 623 640 N/A INTRINSIC
ZnF_C2H2 648 670 4.47e-3 SMART
ZnF_C2H2 676 698 8.22e-2 SMART
ZnF_C2H2 704 726 2.27e-4 SMART
ZnF_C2H2 732 754 1.28e-3 SMART
ZnF_C2H2 763 785 2.95e-3 SMART
ZnF_C2H2 791 813 7.67e-2 SMART
ZnF_C2H2 819 843 2.95e-3 SMART
ZnF_C2H2 855 877 1.67e-2 SMART
ZnF_C2H2 883 905 3.02e0 SMART
ZnF_C2H2 911 934 9.58e-3 SMART
low complexity region 979 994 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,065,735 I1278V possibly damaging Het
Baz1b A G 5: 135,237,967 H1210R probably damaging Het
Cdt1 C T 8: 122,569,331 S128L probably benign Het
Cfap54 A T 10: 92,964,536 N1603K unknown Het
Cfap99 A G 5: 34,311,682 N300S possibly damaging Het
Chrdl2 G A 7: 100,027,733 probably null Het
Cpb2 C A 14: 75,272,575 F258L probably damaging Het
Csmd3 A T 15: 48,004,822 D767E probably damaging Het
Dennd3 C T 15: 73,562,349 T956I probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Emcn A G 3: 137,423,467 T245A possibly damaging Het
Gm4353 A G 7: 116,083,629 V239A probably damaging Het
Gm4884 G A 7: 41,043,386 A260T probably damaging Het
Hectd4 A G 5: 121,308,358 D205G possibly damaging Het
Hectd4 A G 5: 121,343,147 S3005G probably benign Het
Ifngr1 T C 10: 19,603,805 L148P probably damaging Het
Irf2 C T 8: 46,818,894 T172M probably damaging Het
Irs1 T C 1: 82,290,249 H82R possibly damaging Het
Kcnc4 G T 3: 107,458,768 N41K probably damaging Het
Lig3 C T 11: 82,792,044 A490V possibly damaging Het
Megf6 G A 4: 154,265,192 E946K probably damaging Het
Mpi A T 9: 57,544,917 Y359N probably damaging Het
Nf1 A G 11: 79,458,883 S1365G probably damaging Het
P3h3 C A 6: 124,851,078 probably null Het
Pdk2 A T 11: 95,039,433 V59D probably damaging Het
Ppip5k2 T C 1: 97,755,888 K168R probably benign Het
Prg4 G T 1: 150,455,567 P452T unknown Het
Prl2b1 T C 13: 27,383,459 N234S possibly damaging Het
Rnd1 T A 15: 98,676,574 T41S possibly damaging Het
Sall4 G A 2: 168,755,910 P337S probably damaging Het
Slc1a2 G A 2: 102,755,953 A301T possibly damaging Het
Sorcs3 C T 19: 48,206,474 R99W possibly damaging Het
Svep1 G A 4: 58,044,053 T3531I possibly damaging Het
Sycp2 T C 2: 178,362,968 D894G probably benign Het
Syne1 T C 10: 5,228,659 N4605S probably benign Het
Syt4 A C 18: 31,440,419 C348G possibly damaging Het
Tceanc2 G A 4: 107,177,581 T28M probably damaging Het
Tmco1 A G 1: 167,308,685 D5G Het
Tnfsf12 T C 11: 69,686,887 K235E probably damaging Het
Trank1 T C 9: 111,391,382 S2396P possibly damaging Het
Vipas39 T A 12: 87,257,417 D125V probably damaging Het
Vmn1r86 A G 7: 13,102,844 F35S probably benign Het
Vmn2r16 A G 5: 109,363,783 N619D probably damaging Het
Vps13a A G 19: 16,740,793 V521A probably benign Het
Wdr20rt T A 12: 65,226,261 L166Q probably damaging Het
Zscan21 A T 5: 138,117,916 Y30F unknown Het
Other mutations in Zbtb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Zbtb11 APN 16 56000602 nonsense probably null
IGL01107:Zbtb11 APN 16 56006007 missense probably damaging 1.00
IGL01341:Zbtb11 APN 16 55990931 missense possibly damaging 0.68
IGL01510:Zbtb11 APN 16 55990343 missense probably damaging 0.99
IGL01611:Zbtb11 APN 16 55980610 missense probably damaging 1.00
IGL01736:Zbtb11 APN 16 55998160 missense probably damaging 1.00
IGL01834:Zbtb11 APN 16 55991008 missense probably benign 0.35
IGL02427:Zbtb11 APN 16 55982350 missense possibly damaging 0.95
IGL02441:Zbtb11 APN 16 55974189 missense possibly damaging 0.94
IGL02455:Zbtb11 APN 16 56000675 missense probably damaging 1.00
PIT4544001:Zbtb11 UTSW 16 55998193 nonsense probably null
R0987:Zbtb11 UTSW 16 55990708 missense probably benign 0.00
R1414:Zbtb11 UTSW 16 55990560 nonsense probably null
R1437:Zbtb11 UTSW 16 55991620 critical splice donor site probably null
R1570:Zbtb11 UTSW 16 55990815 missense probably benign
R1658:Zbtb11 UTSW 16 55974225 missense possibly damaging 0.71
R1735:Zbtb11 UTSW 16 55990682 missense probably benign
R2048:Zbtb11 UTSW 16 55998009 missense probably damaging 1.00
R2925:Zbtb11 UTSW 16 55974084 missense probably benign 0.00
R4072:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R4075:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R4076:Zbtb11 UTSW 16 55998064 missense possibly damaging 0.89
R5023:Zbtb11 UTSW 16 56006065 missense probably damaging 1.00
R5755:Zbtb11 UTSW 16 56000713 missense probably benign 0.02
R5757:Zbtb11 UTSW 16 56007029 missense probably damaging 1.00
R6218:Zbtb11 UTSW 16 55998073 missense probably benign 0.00
R6313:Zbtb11 UTSW 16 55990491 missense probably benign 0.03
R6461:Zbtb11 UTSW 16 56006871 missense probably damaging 0.99
R6666:Zbtb11 UTSW 16 56006252 missense probably damaging 1.00
R6807:Zbtb11 UTSW 16 55990502 missense probably benign 0.03
R7194:Zbtb11 UTSW 16 56007188 missense probably damaging 1.00
R7424:Zbtb11 UTSW 16 55990487 missense probably benign 0.01
R8022:Zbtb11 UTSW 16 56006020 missense probably damaging 0.99
R8532:Zbtb11 UTSW 16 55990889 missense probably benign 0.03
R8806:Zbtb11 UTSW 16 55982274 missense probably damaging 1.00
RF014:Zbtb11 UTSW 16 55980597 missense probably damaging 0.97
Z1176:Zbtb11 UTSW 16 55991502 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTAAGATCCTTGGTATTTGTAGCTTC -3'
(R):5'- GCATATGACTTACTCCACTCTGGG -3'

Sequencing Primer
(F):5'- CCTTGGTATTTGTAGCTTCATCTAAC -3'
(R):5'- GCTATGTAGACCAGACTTGCCTAG -3'
Posted On2020-10-20