Incidental Mutation 'R8437:Olfr1416'
ID654024
Institutional Source Beutler Lab
Gene Symbol Olfr1416
Ensembl Gene ENSMUSG00000067064
Gene Nameolfactory receptor 1416
SynonymsMOR103-3, GA_x6K02T2R7CC-81277975-81278913
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R8437 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location92475925-92485113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92480465 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 52 (S52N)
Ref Sequence ENSEMBL: ENSMUSP00000149576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086837] [ENSMUST00000214928]
Predicted Effect probably benign
Transcript: ENSMUST00000086837
AA Change: S52N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084048
Gene: ENSMUSG00000067064
AA Change: S52N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.9e-53 PFAM
Pfam:7tm_1 41 290 6.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214928
AA Change: S52N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Olfr1416
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Olfr1416 APN 1 92480024 missense probably damaging 0.99
IGL00980:Olfr1416 APN 1 92479680 splice site probably null
IGL01540:Olfr1416 APN 1 92480480 missense probably damaging 0.96
BB007:Olfr1416 UTSW 1 92479848 missense probably benign 0.01
BB017:Olfr1416 UTSW 1 92479848 missense probably benign 0.01
R1146:Olfr1416 UTSW 1 92479890 missense probably damaging 1.00
R1146:Olfr1416 UTSW 1 92479890 missense probably damaging 1.00
R4751:Olfr1416 UTSW 1 92479983 missense probably benign 0.01
R5207:Olfr1416 UTSW 1 92479872 missense probably benign
R5287:Olfr1416 UTSW 1 92480297 missense possibly damaging 0.88
R5403:Olfr1416 UTSW 1 92480297 missense possibly damaging 0.88
R6074:Olfr1416 UTSW 1 92479775 missense probably benign 0.45
R6232:Olfr1416 UTSW 1 92480583 missense probably benign 0.00
R6355:Olfr1416 UTSW 1 92479980 missense probably benign 0.21
R6378:Olfr1416 UTSW 1 92480456 missense probably damaging 1.00
R6901:Olfr1416 UTSW 1 92480605 missense probably damaging 1.00
R7930:Olfr1416 UTSW 1 92479848 missense probably benign 0.01
R8280:Olfr1416 UTSW 1 92480007 missense noncoding transcript
R8351:Olfr1416 UTSW 1 92479938 missense probably benign 0.09
R8451:Olfr1416 UTSW 1 92479938 missense probably benign 0.09
X0065:Olfr1416 UTSW 1 92479762 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAGCCAGGAGTACACAC -3'
(R):5'- GATACTTGGCCCTTCCTATCGG -3'

Sequencing Primer
(F):5'- ACTCTGTACATACCAGGGAGCTG -3'
(R):5'- CGGCCTCTTGATCTTTTGCAGG -3'
Posted On2020-10-20