Incidental Mutation 'R8437:Celf2'
ID654025
Institutional Source Beutler Lab
Gene Symbol Celf2
Ensembl Gene ENSMUSG00000002107
Gene NameCUGBP, Elav-like family member 2
SynonymsNapor-2, ETR-3, B230345P09Rik, Cugbp2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R8437 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location6539694-7509563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6547145 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 508 (G508S)
Ref Sequence ENSEMBL: ENSMUSP00000110574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002176] [ENSMUST00000100429] [ENSMUST00000114924] [ENSMUST00000114927] [ENSMUST00000114934] [ENSMUST00000142941] [ENSMUST00000150624] [ENSMUST00000170438] [ENSMUST00000182706] [ENSMUST00000182851] [ENSMUST00000182879] [ENSMUST00000183091] [ENSMUST00000183209] [ENSMUST00000183984]
Predicted Effect probably damaging
Transcript: ENSMUST00000002176
AA Change: G466S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002176
Gene: ENSMUSG00000002107
AA Change: G466S

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 326 355 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
RRM 400 473 3.2e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100429
AA Change: G466S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097996
Gene: ENSMUSG00000002107
AA Change: G466S

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
RRM 406 479 3.2e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114924
AA Change: G508S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110574
Gene: ENSMUSG00000002107
AA Change: G508S

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114927
AA Change: G470S

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110577
Gene: ENSMUSG00000002107
AA Change: G470S

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 359 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
RRM 404 477 3.2e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114934
AA Change: G508S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110584
Gene: ENSMUSG00000002107
AA Change: G508S

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142941
AA Change: G472S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120459
Gene: ENSMUSG00000002107
AA Change: G472S

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
RRM 406 479 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150624
AA Change: G470S

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138297
Gene: ENSMUSG00000002107
AA Change: G470S

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 359 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
RRM 404 477 3.2e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170438
AA Change: G460S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130829
Gene: ENSMUSG00000002107
AA Change: G460S

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
RRM 384 467 4.92e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182706
AA Change: G502S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138764
Gene: ENSMUSG00000002107
AA Change: G502S

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 362 391 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
RRM 436 509 3.2e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182851
AA Change: G490S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138363
Gene: ENSMUSG00000002107
AA Change: G490S

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
low complexity region 350 379 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
RRM 424 497 3.2e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182879
AA Change: G422S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138359
Gene: ENSMUSG00000002107
AA Change: G422S

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
RRM 346 429 4.92e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183091
AA Change: G442S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138795
Gene: ENSMUSG00000002107
AA Change: G442S

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
RRM 366 449 4.92e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183209
AA Change: G454S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138355
Gene: ENSMUSG00000002107
AA Change: G454S

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
RRM 378 461 4.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183984
SMART Domains Protein: ENSMUSP00000138974
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
RRM 104 182 1.29e-17 SMART
RRM 196 271 4.22e-22 SMART
low complexity region 281 310 N/A INTRINSIC
low complexity region 339 366 N/A INTRINSIC
low complexity region 368 380 N/A INTRINSIC
Meta Mutation Damage Score 0.3119 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Celf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Celf2 APN 2 6721577 missense probably benign 0.00
IGL01974:Celf2 APN 2 6604031 missense probably damaging 1.00
IGL02159:Celf2 APN 2 6604177 nonsense probably null
LCD18:Celf2 UTSW 2 6779076 intron probably benign
R0113:Celf2 UTSW 2 6624714 missense probably damaging 1.00
R0511:Celf2 UTSW 2 6604176 missense probably damaging 1.00
R0711:Celf2 UTSW 2 6721415 critical splice donor site probably null
R1755:Celf2 UTSW 2 6884958 start codon destroyed probably benign 0.01
R1802:Celf2 UTSW 2 6549933 missense probably damaging 1.00
R1898:Celf2 UTSW 2 6604164 missense probably damaging 1.00
R1912:Celf2 UTSW 2 6615753 missense probably damaging 1.00
R2422:Celf2 UTSW 2 6553889 missense probably damaging 1.00
R2848:Celf2 UTSW 2 6604125 missense probably damaging 0.96
R2849:Celf2 UTSW 2 6604125 missense probably damaging 0.96
R3708:Celf2 UTSW 2 6624678 missense probably damaging 1.00
R4295:Celf2 UTSW 2 6604064 missense probably benign 0.10
R4601:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4602:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4610:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4611:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4667:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4668:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4669:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4790:Celf2 UTSW 2 6549903 missense probably damaging 1.00
R5022:Celf2 UTSW 2 6607847 intron probably benign
R5369:Celf2 UTSW 2 7081081 intron probably benign
R5540:Celf2 UTSW 2 6553932 missense probably benign 0.43
R5805:Celf2 UTSW 2 6553787 missense probably damaging 1.00
R5913:Celf2 UTSW 2 7081158 start codon destroyed probably null 0.02
R6330:Celf2 UTSW 2 6884955 missense probably benign 0.05
R7505:Celf2 UTSW 2 6624700 missense probably damaging 1.00
R7662:Celf2 UTSW 2 6553917 missense probably damaging 1.00
R8316:Celf2 UTSW 2 6547103 missense probably benign 0.03
R8860:Celf2 UTSW 2 6560657 critical splice donor site probably null
X0018:Celf2 UTSW 2 6553913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTTGGCATCGTGGTCCC -3'
(R):5'- ATTACTTCCCAGTTGGCATGC -3'

Sequencing Primer
(F):5'- GGCATCGTGGTCCCTCCTC -3'
(R):5'- GCACCTCTCAGCATTGCAG -3'
Posted On2020-10-20