Incidental Mutation 'R8437:Uck1'
ID654027
Institutional Source Beutler Lab
Gene Symbol Uck1
Ensembl Gene ENSMUSG00000002550
Gene Nameuridine-cytidine kinase 1
SynonymsURK1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8437 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32255002-32260159 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 32260141 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000002625]
Predicted Effect probably benign
Transcript: ENSMUST00000002625
SMART Domains Protein: ENSMUSP00000002625
Gene: ENSMUSG00000002550

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:CoaE 30 198 1.1e-8 PFAM
Pfam:AAA_17 31 188 3.8e-8 PFAM
Pfam:PRK 31 225 1.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138133
SMART Domains Protein: ENSMUSP00000125350
Gene: ENSMUSG00000002550

DomainStartEndE-ValueType
Pfam:PRK 1 151 1e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Uck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Uck1 APN 2 32259669 missense probably damaging 1.00
IGL01765:Uck1 APN 2 32258676 unclassified probably benign
IGL02028:Uck1 APN 2 32258137 missense probably damaging 1.00
IGL02863:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03114:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03159:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03325:Uck1 APN 2 32258322 missense probably benign 0.04
PIT4378001:Uck1 UTSW 2 32256034 missense probably damaging 1.00
R1019:Uck1 UTSW 2 32256193 missense possibly damaging 0.88
R1332:Uck1 UTSW 2 32259654 missense probably damaging 1.00
R1336:Uck1 UTSW 2 32259654 missense probably damaging 1.00
R1428:Uck1 UTSW 2 32258355 missense probably damaging 1.00
R2173:Uck1 UTSW 2 32256076 unclassified probably benign
R2233:Uck1 UTSW 2 32258303 missense probably damaging 1.00
R2234:Uck1 UTSW 2 32258303 missense probably damaging 1.00
R2938:Uck1 UTSW 2 32256076 unclassified probably benign
R3079:Uck1 UTSW 2 32258077 unclassified probably benign
R4667:Uck1 UTSW 2 32256034 missense probably damaging 1.00
R5036:Uck1 UTSW 2 32258466 unclassified probably benign
R6463:Uck1 UTSW 2 32258655 missense probably benign 0.00
R7072:Uck1 UTSW 2 32258166 missense probably damaging 1.00
R7690:Uck1 UTSW 2 32258172 missense probably benign 0.03
R8021:Uck1 UTSW 2 32259917 missense probably benign 0.17
R8415:Uck1 UTSW 2 32260141 unclassified probably benign
R8416:Uck1 UTSW 2 32260141 unclassified probably benign
R8438:Uck1 UTSW 2 32260141 unclassified probably benign
R8440:Uck1 UTSW 2 32260141 unclassified probably benign
R8442:Uck1 UTSW 2 32260141 unclassified probably benign
R8530:Uck1 UTSW 2 32260141 unclassified probably benign
R8537:Uck1 UTSW 2 32260141 unclassified probably benign
R8749:Uck1 UTSW 2 32256512 missense
Predicted Primers PCR Primer
(F):5'- AGTGAGCTTGTGCACTGAG -3'
(R):5'- ATAAGGCAGGGACGGTCCTAAC -3'

Sequencing Primer
(F):5'- AGCTTGTGCACTGAGTGACC -3'
(R):5'- ACGGTCCTAACCCTGTGG -3'
Posted On2020-10-20