Incidental Mutation 'R8437:Hnrnpa3'
ID654028
Institutional Source Beutler Lab
Gene Symbol Hnrnpa3
Ensembl Gene ENSMUSG00000059005
Gene Nameheterogeneous nuclear ribonucleoprotein A3
SynonymsHnrpa3, 2610510D13Rik, 2410013L13Rik, 2610209F03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R8437 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location75659261-75669407 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 75662675 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 220 (S220A)
Ref Sequence ENSEMBL: ENSMUSP00000107595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090792] [ENSMUST00000111961] [ENSMUST00000111962] [ENSMUST00000111964] [ENSMUST00000141974] [ENSMUST00000164947]
Predicted Effect unknown
Transcript: ENSMUST00000090792
AA Change: S220A
SMART Domains Protein: ENSMUSP00000088298
Gene: ENSMUSG00000059005
AA Change: S220A

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
RRM 36 108 4.06e-24 SMART
RRM 127 199 1.94e-21 SMART
low complexity region 211 338 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111961
AA Change: S220A
SMART Domains Protein: ENSMUSP00000107592
Gene: ENSMUSG00000059005
AA Change: S220A

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
RRM 36 108 4.06e-24 SMART
RRM 127 199 1.94e-21 SMART
Pfam:HnRNPA1 266 303 8.4e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000111962
AA Change: S198A
SMART Domains Protein: ENSMUSP00000107593
Gene: ENSMUSG00000059005
AA Change: S198A

DomainStartEndE-ValueType
RRM 14 86 4.06e-24 SMART
RRM 105 177 1.94e-21 SMART
low complexity region 189 316 N/A INTRINSIC
low complexity region 327 356 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111964
AA Change: S220A
SMART Domains Protein: ENSMUSP00000107595
Gene: ENSMUSG00000059005
AA Change: S220A

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
RRM 36 108 4.06e-24 SMART
RRM 127 199 1.94e-21 SMART
low complexity region 211 338 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141974
AA Change: S35A
SMART Domains Protein: ENSMUSP00000116125
Gene: ENSMUSG00000059005
AA Change: S35A

DomainStartEndE-ValueType
PDB:2UP1|A 1 25 7e-8 PDB
low complexity region 26 153 N/A INTRINSIC
low complexity region 164 193 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000164947
AA Change: S198A
SMART Domains Protein: ENSMUSP00000126069
Gene: ENSMUSG00000059005
AA Change: S198A

DomainStartEndE-ValueType
RRM 14 86 4.06e-24 SMART
RRM 105 177 1.94e-21 SMART
low complexity region 189 316 N/A INTRINSIC
low complexity region 327 356 N/A INTRINSIC
Meta Mutation Damage Score 0.0691 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Hnrnpa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0076:Hnrnpa3 UTSW 2 75661696 missense probably damaging 1.00
R0095:Hnrnpa3 UTSW 2 75661696 missense probably damaging 1.00
R4583:Hnrnpa3 UTSW 2 75663606 missense probably benign 0.23
R4762:Hnrnpa3 UTSW 2 75662007 missense possibly damaging 0.95
R5499:Hnrnpa3 UTSW 2 75665240 missense probably benign 0.23
R5802:Hnrnpa3 UTSW 2 75665056 missense unknown
R6253:Hnrnpa3 UTSW 2 75662570 missense possibly damaging 0.82
R8233:Hnrnpa3 UTSW 2 75662516 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGAAATACCACACTATTAATGGGC -3'
(R):5'- TTGAGGCCTTGTGATTCCC -3'

Sequencing Primer
(F):5'- CCACACTATTAATGGGCATAATTGTG -3'
(R):5'- TGTGATTCCCAGCAATGCAG -3'
Posted On2020-10-20