Incidental Mutation 'R8437:C8b'
ID654035
Institutional Source Beutler Lab
Gene Symbol C8b
Ensembl Gene ENSMUSG00000029656
Gene Namecomplement component 8, beta polypeptide
Synonyms4930439B20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8437 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location104766317-104804548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104786843 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 236 (Y236H)
Ref Sequence ENSEMBL: ENSMUSP00000031663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031663] [ENSMUST00000065072]
Predicted Effect probably damaging
Transcript: ENSMUST00000031663
AA Change: Y236H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031663
Gene: ENSMUSG00000029656
AA Change: Y236H

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 290 497 3.6e-65 SMART
Blast:EGF 501 534 9e-12 BLAST
TSP1 547 584 1.17e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065072
SMART Domains Protein: ENSMUSP00000066940
Gene: ENSMUSG00000029656

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 224 431 3.6e-65 SMART
Blast:EGF 435 468 1e-11 BLAST
TSP1 481 518 1.17e-1 SMART
Meta Mutation Damage Score 0.2170 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the beta subunit, which associates with the alpha and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the alpha subunit. [provided by RefSeq, Oct 2015]
PHENOTYPE: In a controlled microbial environment ("clean") laboratory, mice homozygous for an inactivating mutation of this gene are viable and fertile and exhibit no apparent abonormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in C8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:C8b APN 4 104801334 splice site probably benign
IGL01145:C8b APN 4 104780580 missense probably benign 0.25
IGL01768:C8b APN 4 104786954 missense probably benign 0.00
IGL02347:C8b APN 4 104786954 missense probably benign 0.00
IGL02488:C8b APN 4 104804081 missense probably benign
IGL02957:C8b APN 4 104766455 missense probably benign
IGL02979:C8b APN 4 104774388 missense probably damaging 0.99
IGL02995:C8b APN 4 104801328 splice site probably benign
IGL03294:C8b APN 4 104780691 missense probably benign 0.06
R0568:C8b UTSW 4 104793380 missense probably benign 0.39
R1015:C8b UTSW 4 104786960 missense probably benign 0.19
R1191:C8b UTSW 4 104793323 missense probably damaging 1.00
R1401:C8b UTSW 4 104784482 missense possibly damaging 0.72
R3824:C8b UTSW 4 104783009 missense probably benign 0.42
R4611:C8b UTSW 4 104790644 missense probably damaging 0.98
R4756:C8b UTSW 4 104786886 missense probably benign
R4845:C8b UTSW 4 104791812 missense possibly damaging 0.87
R5355:C8b UTSW 4 104780663 missense probably benign 0.01
R5436:C8b UTSW 4 104800349 nonsense probably null
R5561:C8b UTSW 4 104784448 missense possibly damaging 0.89
R5967:C8b UTSW 4 104793333 missense possibly damaging 0.79
R6744:C8b UTSW 4 104774346 missense probably damaging 1.00
R6899:C8b UTSW 4 104786874 missense probably benign 0.02
R6977:C8b UTSW 4 104786996 missense possibly damaging 0.82
R7088:C8b UTSW 4 104793343 missense probably benign 0.12
R7224:C8b UTSW 4 104780598 missense probably damaging 1.00
R7278:C8b UTSW 4 104780627 missense probably damaging 1.00
R8058:C8b UTSW 4 104790614 missense probably damaging 0.96
R8821:C8b UTSW 4 104790677 missense probably damaging 1.00
R8831:C8b UTSW 4 104790677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGTATTGAATATGTCTGTCTG -3'
(R):5'- TAAATGGGTACTTACAGTGTGGGC -3'

Sequencing Primer
(F):5'- CAGAGGTCCTGGATATAAGCTGTCC -3'
(R):5'- CCACTTTAAAACCAGACGTG -3'
Posted On2020-10-20