Incidental Mutation 'R8437:Zyg11a'
ID654036
Institutional Source Beutler Lab
Gene Symbol Zyg11a
Ensembl Gene ENSMUSG00000034645
Gene Namezyg-11 family member A, cell cycle regulator
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R8437 (G1)
Quality Score143.008
Status Validated
Chromosome4
Chromosomal Location108181738-108218048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108217906 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 6 (H6L)
Ref Sequence ENSEMBL: ENSMUSP00000152477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043793] [ENSMUST00000106690] [ENSMUST00000223127]
Predicted Effect probably damaging
Transcript: ENSMUST00000043793
AA Change: H6L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038478
Gene: ENSMUSG00000034645
AA Change: H6L

DomainStartEndE-ValueType
SCOP:d1jdha_ 218 700 2e-11 SMART
Blast:ARM 497 544 1e-5 BLAST
Blast:ARM 547 587 5e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106690
AA Change: H6L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102301
Gene: ENSMUSG00000034645
AA Change: H6L

DomainStartEndE-ValueType
SCOP:d1jdha_ 139 621 1e-11 SMART
Blast:ARM 418 465 1e-5 BLAST
Blast:ARM 468 508 1e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000223127
AA Change: H6L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Other mutations in Zyg11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Zyg11a APN 4 108204902 missense probably damaging 0.99
IGL01517:Zyg11a APN 4 108201194 missense probably null 1.00
IGL01619:Zyg11a APN 4 108205217 missense probably damaging 1.00
IGL02253:Zyg11a APN 4 108183695 missense probably null 0.99
R0090:Zyg11a UTSW 4 108201347 splice site probably benign
R0225:Zyg11a UTSW 4 108204641 missense probably damaging 1.00
R0610:Zyg11a UTSW 4 108204857 missense probably damaging 1.00
R0827:Zyg11a UTSW 4 108210042 splice site probably benign
R1568:Zyg11a UTSW 4 108183646 critical splice donor site probably null
R1752:Zyg11a UTSW 4 108205282 missense possibly damaging 0.81
R2051:Zyg11a UTSW 4 108192047 splice site probably benign
R2358:Zyg11a UTSW 4 108196146 missense possibly damaging 0.94
R3898:Zyg11a UTSW 4 108210194 missense probably damaging 0.99
R4288:Zyg11a UTSW 4 108184469 missense probably damaging 1.00
R4381:Zyg11a UTSW 4 108201320 missense possibly damaging 0.58
R4709:Zyg11a UTSW 4 108205071 missense probably benign 0.00
R4859:Zyg11a UTSW 4 108210190 missense probably damaging 0.98
R5303:Zyg11a UTSW 4 108184432 critical splice donor site probably null
R5349:Zyg11a UTSW 4 108183732 missense probably damaging 1.00
R5363:Zyg11a UTSW 4 108189622 missense probably damaging 1.00
R5517:Zyg11a UTSW 4 108204746 missense possibly damaging 0.94
R6175:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R6254:Zyg11a UTSW 4 108181794 missense probably damaging 1.00
R6678:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R7524:Zyg11a UTSW 4 108192074 missense probably damaging 1.00
R7789:Zyg11a UTSW 4 108183648 missense probably damaging 1.00
R8022:Zyg11a UTSW 4 108189568 critical splice donor site probably null
X0061:Zyg11a UTSW 4 108193993 missense probably damaging 1.00
Z1176:Zyg11a UTSW 4 108201282 missense probably damaging 1.00
Z1177:Zyg11a UTSW 4 108204800 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TATGGCTGGGGTTCGAACTC -3'
(R):5'- TACAATGAGGAACGCTGTGC -3'

Sequencing Primer
(F):5'- TTCGAACTCGGGCGCCTTC -3'
(R):5'- CTGTGCGTGCTATGCGAAC -3'
Posted On2020-10-20