Incidental Mutation 'R8437:Sae1'
ID 654040
Institutional Source Beutler Lab
Gene Symbol Sae1
Ensembl Gene ENSMUSG00000052833
Gene Name SUMO1 activating enzyme subunit 1
Synonyms 2400010M20Rik, SUMO-1 activating enzyme subunit 1, HSPC140, AOS1, Uble1a, 2610044L12Rik, D7Ertd177e
MMRRC Submission 067901-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R8437 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 16054159-16121731 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16104279 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 110 (V110A)
Ref Sequence ENSEMBL: ENSMUSP00000092409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094815] [ENSMUST00000210999] [ENSMUST00000211741]
AlphaFold Q9R1T2
Predicted Effect probably damaging
Transcript: ENSMUST00000094815
AA Change: V110A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092409
Gene: ENSMUSG00000052833
AA Change: V110A

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:ThiF 23 344 4.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210999
AA Change: V110A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211741
AA Change: V110A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 78,998,178 (GRCm39) Y237H probably damaging Het
Adprh T C 16: 38,266,449 (GRCm39) E231G probably benign Het
Anks6 T C 4: 47,030,705 (GRCm39) S631G probably benign Het
Bpifa5 T A 2: 154,007,526 (GRCm39) L156H probably damaging Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
C8b T C 4: 104,644,040 (GRCm39) Y236H probably damaging Het
Celf2 C T 2: 6,551,956 (GRCm39) G508S probably damaging Het
Clca3a1 T C 3: 144,710,822 (GRCm39) T794A probably benign Het
Col27a1 T A 4: 63,237,701 (GRCm39) probably benign Het
Cyp2j12 C T 4: 95,987,899 (GRCm39) C497Y probably damaging Het
Dnmt3l T C 10: 77,888,602 (GRCm39) I168T possibly damaging Het
Dtna C T 18: 23,723,398 (GRCm39) Q201* probably null Het
Fetub T C 16: 22,752,985 (GRCm39) S146P possibly damaging Het
Gak T G 5: 108,757,272 (GRCm39) E242D probably benign Het
Gfpt2 T A 11: 49,695,694 (GRCm39) probably benign Het
Ginm1 C T 10: 7,646,130 (GRCm39) C290Y probably benign Het
Hepacam T C 9: 37,296,006 (GRCm39) S386P probably damaging Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Hnrnpa3 T G 2: 75,493,019 (GRCm39) S220A unknown Het
Hydin A G 8: 111,189,367 (GRCm39) E1257G probably damaging Het
Ier3ip1 C T 18: 77,017,874 (GRCm39) A18V probably damaging Het
Ift140 T A 17: 25,313,651 (GRCm39) C1361S probably damaging Het
Il16 T C 7: 83,301,351 (GRCm39) Q955R probably damaging Het
Itpr3 T G 17: 27,326,277 (GRCm39) M1349R probably damaging Het
Kcnk4 C T 19: 6,903,602 (GRCm39) V316I probably benign Het
Marchf6 A G 15: 31,482,695 (GRCm39) I501T possibly damaging Het
Msl2 T A 9: 100,978,167 (GRCm39) S180R probably benign Het
Muc16 C T 9: 18,569,220 (GRCm39) V1100I unknown Het
Nbas T C 12: 13,616,251 (GRCm39) V2263A possibly damaging Het
Or6b2 C T 1: 92,408,187 (GRCm39) S52N probably benign Het
Or7g33 C T 9: 19,448,833 (GRCm39) R131H probably benign Het
Pdilt T G 7: 119,114,109 (GRCm39) I130L possibly damaging Het
Phldb3 A G 7: 24,328,375 (GRCm39) T640A probably damaging Het
Pole2 G C 12: 69,250,961 (GRCm39) Y467* probably null Het
Pxdn C T 12: 30,052,043 (GRCm39) T740M probably damaging Het
Rabac1 T C 7: 24,671,672 (GRCm39) I83V probably damaging Het
Rrp7a T C 15: 83,001,773 (GRCm39) Q245R probably damaging Het
Sema3c G T 5: 17,867,936 (GRCm39) V116F probably damaging Het
Serpina3i A G 12: 104,231,963 (GRCm39) Y200C probably damaging Het
Slc25a45 C T 19: 5,930,135 (GRCm39) T35M probably benign Het
Speer4b C T 5: 27,703,818 (GRCm39) R107Q probably benign Het
Sycp2 T C 2: 178,006,651 (GRCm39) T843A probably damaging Het
Tecta T A 9: 42,243,856 (GRCm39) I2004F probably damaging Het
Tma16 T C 8: 66,929,448 (GRCm39) D182G possibly damaging Het
Topaz1 T A 9: 122,610,427 (GRCm39) Y1167* probably null Het
Uck1 C A 2: 32,150,153 (GRCm39) probably benign Het
Usp25 A G 16: 76,830,800 (GRCm39) T19A probably damaging Het
Vpreb1b G A 16: 17,798,753 (GRCm39) G80S probably damaging Het
Wdfy4 A G 14: 32,798,332 (GRCm39) C2025R Het
Zyg11a T A 4: 108,075,103 (GRCm39) H6L probably damaging Het
Other mutations in Sae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Sae1 APN 7 16,064,581 (GRCm39) missense possibly damaging 0.94
IGL02672:Sae1 APN 7 16,104,273 (GRCm39) missense probably damaging 1.00
IGL02881:Sae1 APN 7 16,093,043 (GRCm39) missense probably damaging 1.00
R0255:Sae1 UTSW 7 16,104,247 (GRCm39) nonsense probably null
R0667:Sae1 UTSW 7 16,102,457 (GRCm39) missense probably damaging 1.00
R1374:Sae1 UTSW 7 16,112,333 (GRCm39) missense probably damaging 0.97
R1585:Sae1 UTSW 7 16,064,537 (GRCm39) critical splice donor site probably null
R1960:Sae1 UTSW 7 16,102,490 (GRCm39) missense possibly damaging 0.90
R2278:Sae1 UTSW 7 16,104,291 (GRCm39) missense probably damaging 1.00
R5513:Sae1 UTSW 7 16,100,781 (GRCm39) missense probably benign 0.00
R5677:Sae1 UTSW 7 16,104,387 (GRCm39) critical splice acceptor site probably null
R6694:Sae1 UTSW 7 16,102,461 (GRCm39) missense probably damaging 1.00
R6975:Sae1 UTSW 7 16,070,712 (GRCm39) missense probably damaging 0.99
R7307:Sae1 UTSW 7 16,102,469 (GRCm39) nonsense probably null
R7914:Sae1 UTSW 7 16,121,648 (GRCm39) missense unknown
R9076:Sae1 UTSW 7 16,070,668 (GRCm39) missense probably benign
Z1177:Sae1 UTSW 7 16,061,796 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAACACTAGGGTTAGAGG -3'
(R):5'- CCAGGCTGAATTCTGTAGGGATG -3'

Sequencing Primer
(F):5'- GTTAGAGGTTAGAGGTATGACTCC -3'
(R):5'- GCTGAATTCTGTAGGGATGATAAC -3'
Posted On 2020-10-20