Incidental Mutation 'R8437:Phldb3'
ID654041
Institutional Source Beutler Lab
Gene Symbol Phldb3
Ensembl Gene ENSMUSG00000074277
Gene Namepleckstrin homology like domain, family B, member 3
SynonymsEG232970, Gm10102
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R8437 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24610763-24629297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24628950 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 640 (T640A)
Ref Sequence ENSEMBL: ENSMUSP00000073047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073325] [ENSMUST00000206422]
Predicted Effect probably damaging
Transcript: ENSMUST00000073325
AA Change: T640A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073047
Gene: ENSMUSG00000074277
AA Change: T640A

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
low complexity region 61 74 N/A INTRINSIC
coiled coil region 111 302 N/A INTRINSIC
low complexity region 364 374 N/A INTRINSIC
Blast:PH 389 447 2e-29 BLAST
Blast:PH 457 488 4e-6 BLAST
low complexity region 490 514 N/A INTRINSIC
PH 541 645 1.54e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206422
AA Change: T640A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Phldb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Phldb3 APN 7 24628870 missense probably damaging 1.00
IGL01683:Phldb3 APN 7 24619437 missense possibly damaging 0.71
IGL01732:Phldb3 APN 7 24627326 missense probably damaging 1.00
IGL01765:Phldb3 APN 7 24617375 missense possibly damaging 0.55
IGL03103:Phldb3 APN 7 24624176 missense possibly damaging 0.71
FR4548:Phldb3 UTSW 7 24628978 makesense probably null
R0052:Phldb3 UTSW 7 24612579 missense probably benign 0.01
R0230:Phldb3 UTSW 7 24612579 missense probably benign 0.01
R0234:Phldb3 UTSW 7 24612579 missense probably benign 0.01
R0655:Phldb3 UTSW 7 24624372 missense probably benign 0.07
R1731:Phldb3 UTSW 7 24619235 missense probably benign 0.10
R1935:Phldb3 UTSW 7 24617407 missense probably benign 0.01
R1936:Phldb3 UTSW 7 24617407 missense probably benign 0.01
R2155:Phldb3 UTSW 7 24612645 missense probably damaging 1.00
R2410:Phldb3 UTSW 7 24624294 missense probably benign 0.01
R4249:Phldb3 UTSW 7 24627320 missense probably damaging 1.00
R4501:Phldb3 UTSW 7 24612561 missense probably benign
R4665:Phldb3 UTSW 7 24611427 missense probably benign 0.00
R4916:Phldb3 UTSW 7 24624291 missense probably benign
R4970:Phldb3 UTSW 7 24624685 missense possibly damaging 0.73
R5017:Phldb3 UTSW 7 24620096 missense probably damaging 1.00
R5112:Phldb3 UTSW 7 24624685 missense possibly damaging 0.73
R5864:Phldb3 UTSW 7 24624146 missense possibly damaging 0.55
R5881:Phldb3 UTSW 7 24626722 critical splice donor site probably null
R6176:Phldb3 UTSW 7 24626702 missense probably damaging 1.00
R6756:Phldb3 UTSW 7 24627331 missense probably damaging 1.00
R6800:Phldb3 UTSW 7 24624152 missense possibly damaging 0.93
R7223:Phldb3 UTSW 7 24624653 missense probably benign
R7485:Phldb3 UTSW 7 24611264 start gained probably benign
R7707:Phldb3 UTSW 7 24626597 missense possibly damaging 0.80
R8094:Phldb3 UTSW 7 24626709 missense probably damaging 1.00
RF010:Phldb3 UTSW 7 24626495 frame shift probably null
RF031:Phldb3 UTSW 7 24626493 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGGGAACAGGCATTCTAGC -3'
(R):5'- AATAAATAGTTCCTTCCACCCCTG -3'

Sequencing Primer
(F):5'- GCATTCTAGCCCAGTTTAGGAAGAC -3'
(R):5'- CTCCTTTCTCAGAGGGC -3'
Posted On2020-10-20