Mutagenetix > Incidental Mutations

Incidental Mutation 'R8437:Muc16'

654048

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R8437 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 18657924 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1100 (V1100I)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000208663
AA Change: V1100I

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (50/50)

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd2	T	C	7: 79,348,430	Y237H	probably damaging	Het
Adprh	T	C	16: 38,446,087	E231G	probably benign	Het
Anks6	T	C	4: 47,030,705	S631G	probably benign	Het
Bpifa5	T	A	2: 154,165,606	L156H	probably damaging	Het
Bsn	G	A	9: 108,111,452	A2367V	probably benign	Het
C8b	T	C	4: 104,786,843	Y236H	probably damaging	Het
Celf2	C	T	2: 6,547,145	G508S	probably damaging	Het
Clca1	T	C	3: 145,005,061	T794A	probably benign	Het
Col27a1	T	A	4: 63,319,464		probably benign	Het
Cyp2j12	C	T	4: 96,099,662	C497Y	probably damaging	Het
Dnmt3l	T	C	10: 78,052,768	I168T	possibly damaging	Het
Dtna	C	T	18: 23,590,341	Q201*	probably null	Het
Fetub	T	C	16: 22,934,235	S146P	possibly damaging	Het
Gak	T	G	5: 108,609,406	E242D	probably benign	Het
Gfpt2	T	A	11: 49,804,867		probably benign	Het
Ginm1	C	T	10: 7,770,366	C290Y	probably benign	Het
Hepacam	T	C	9: 37,384,710	S386P	probably damaging	Het
Hmcn2	C	A	2: 31,391,076	L1867I	probably benign	Het
Hnrnpa3	T	G	2: 75,662,675	S220A	unknown	Het
Hydin	A	G	8: 110,462,735	E1257G	probably damaging	Het
Ier3ip1	C	T	18: 76,930,178	A18V	probably damaging	Het
Ift140	T	A	17: 25,094,677	C1361S	probably damaging	Het
Il16	T	C	7: 83,652,143	Q955R	probably damaging	Het
Itpr3	T	G	17: 27,107,303	M1349R	probably damaging	Het
Kcnk4	C	T	19: 6,926,234	V316I	probably benign	Het
March6	A	G	15: 31,482,549	I501T	possibly damaging	Het
Msl2	T	A	9: 101,100,968	S180R	probably benign	Het
Nbas	T	C	12: 13,566,250	V2263A	possibly damaging	Het
Olfr1416	C	T	1: 92,480,465	S52N	probably benign	Het
Olfr853	C	T	9: 19,537,537	R131H	probably benign	Het
Pdilt	T	G	7: 119,514,886	I130L	possibly damaging	Het
Phldb3	A	G	7: 24,628,950	T640A	probably damaging	Het
Pole2	G	C	12: 69,204,187	Y467*	probably null	Het
Pxdn	C	T	12: 30,002,044	T740M	probably damaging	Het
Rabac1	T	C	7: 24,972,247	I83V	probably damaging	Het
Rrp7a	T	C	15: 83,117,572	Q245R	probably damaging	Het
Sae1	A	G	7: 16,370,354	V110A	probably damaging	Het
Sema3c	G	T	5: 17,662,938	V116F	probably damaging	Het
Serpina3i	A	G	12: 104,265,704	Y200C	probably damaging	Het
Slc25a45	C	T	19: 5,880,107	T35M	probably benign	Het
Speer4b	C	T	5: 27,498,820	R107Q	probably benign	Het
Sycp2	T	C	2: 178,364,858	T843A	probably damaging	Het
Tecta	T	A	9: 42,332,560	I2004F	probably damaging	Het
Tma16	T	C	8: 66,476,796	D182G	possibly damaging	Het
Topaz1	T	A	9: 122,781,362	Y1167*	probably null	Het
Uck1	C	A	2: 32,260,141		probably benign	Het
Usp25	A	G	16: 77,033,912	T19A	probably damaging	Het
Vpreb2	G	A	16: 17,980,889	G80S	probably damaging	Het
Wdfy4	A	G	14: 33,076,375	C2025R		Het
Zyg11a	T	A	4: 108,217,906	H6L	probably damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R7038_muc16_859	UTSW	9	18620468	missense	probably damaging	0.99
Runneymeade	UTSW	9	18579317	critical splice donor site	probably null
slimey	UTSW	9	18590698	missense	probably damaging	1.00
viscous	UTSW	9	18644732	missense	unknown
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	splice site	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	splice site	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7921:Muc16	UTSW	9	18659318	missense	unknown
R7922:Muc16	UTSW	9	18584825	missense	probably benign	0.16
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7957:Muc16	UTSW	9	18643471	missense	unknown
R7972:Muc16	UTSW	9	18645764	nonsense	probably null
R7992:Muc16	UTSW	9	18656429	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
R8088:Muc16	UTSW	9	18519300	nonsense	probably null
R8095:Muc16	UTSW	9	18584830	nonsense	probably null
R8111:Muc16	UTSW	9	18592629	missense	possibly damaging	0.55
R8116:Muc16	UTSW	9	18658737	missense	unknown
R8117:Muc16	UTSW	9	18508910	nonsense	probably null
R8137:Muc16	UTSW	9	18645676	missense	unknown
R8196:Muc16	UTSW	9	18645334	missense	unknown
R8218:Muc16	UTSW	9	18637019	missense	possibly damaging	0.48
R8285:Muc16	UTSW	9	18642977	missense	unknown
R8313:Muc16	UTSW	9	18525147	missense	possibly damaging	0.85
R8317:Muc16	UTSW	9	18658043	missense	unknown
R8342:Muc16	UTSW	9	18658685	missense	unknown
R8351:Muc16	UTSW	9	18659885	missense	unknown
R8356:Muc16	UTSW	9	18658778	missense	unknown
R8360:Muc16	UTSW	9	18525258	missense	probably benign	0.01
R8418:Muc16	UTSW	9	18519630	missense	possibly damaging	0.94
R8420:Muc16	UTSW	9	18537511	missense	probably damaging	0.99
R8463:Muc16	UTSW	9	18659139	missense	unknown
R8466:Muc16	UTSW	9	18643148	missense	unknown
R8512:Muc16	UTSW	9	18638192	missense	probably benign	0.01
R8518:Muc16	UTSW	9	18519631	missense	probably benign	0.12
R8556:Muc16	UTSW	9	18640937	missense	probably benign	0.01
R8679:Muc16	UTSW	9	18646448	missense	unknown
R8680:Muc16	UTSW	9	18644719	missense	unknown
R8720:Muc16	UTSW	9	18641600	missense	probably benign	0.01
R8729:Muc16	UTSW	9	18660050	missense	unknown
R8736:Muc16	UTSW	9	18550843	nonsense	probably null
R8739:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R8807:Muc16	UTSW	9	18656057	missense	unknown
R8830:Muc16	UTSW	9	18646069	missense	unknown
R8871:Muc16	UTSW	9	18656048	missense	unknown
R8884:Muc16	UTSW	9	18644200	missense	unknown
R8923:Muc16	UTSW	9	18638676	missense	probably benign	0.01
R8948:Muc16	UTSW	9	18647233	missense	unknown
R8949:Muc16	UTSW	9	18520925	critical splice donor site	probably null
R8987:Muc16	UTSW	9	18551685	nonsense	probably null
R9013:Muc16	UTSW	9	18512773	missense	possibly damaging	0.94
R9020:Muc16	UTSW	9	18638719	small insertion	probably benign
R9036:Muc16	UTSW	9	18644679	missense	unknown
R9040:Muc16	UTSW	9	18644786	nonsense	probably null
R9065:Muc16	UTSW	9	18643009	missense	unknown
R9089:Muc16	UTSW	9	18644550	missense	unknown
R9098:Muc16	UTSW	9	18643679	missense	unknown
R9100:Muc16	UTSW	9	18645670	missense	unknown
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTGGAAAGTTCAGATGGCACTG -3'
(R):5'- AGGGCTCCTTTCAACAATCTTG -3'

Sequencing Primer
(F):5'- TCAGATGGCACTGAAACAGATGTG -3'
(R):5'- GCTTCAGCATCATGGACACC -3'

Posted On

2020-10-20