Incidental Mutation 'R8437:Hepacam'
ID 654050
Institutional Source Beutler Lab
Gene Symbol Hepacam
Ensembl Gene ENSMUSG00000046240
Gene Name hepatocyte cell adhesion molecule
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R8437 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 37367351-37386575 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37384710 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 386 (S386P)
Ref Sequence ENSEMBL: ENSMUSP00000054105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051839] [ENSMUST00000215951]
AlphaFold Q640R3
Predicted Effect probably damaging
Transcript: ENSMUST00000051839
AA Change: S386P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000054105
Gene: ENSMUSG00000046240
AA Change: S386P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IG 40 142 1e-3 SMART
IGc2 159 224 1.48e-6 SMART
transmembrane domain 241 263 N/A INTRINSIC
low complexity region 264 274 N/A INTRINSIC
low complexity region 337 356 N/A INTRINSIC
low complexity region 358 372 N/A INTRINSIC
low complexity region 379 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215951
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein that localizes to the cytoplasmic side of the cell membrane. The encoded protein acts as a homodimer and is involved in cell motility and cell-matrix interactions. The expression of this gene is downregulated or undetectable in many cancer cell lines, so this may be a tumor suppressor gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele display myelin vacuolization that progresses with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Hepacam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Hepacam APN 9 37380616 missense probably damaging 1.00
R0924:Hepacam UTSW 9 37383928 splice site probably benign
R1659:Hepacam UTSW 9 37380658 missense probably benign 0.08
R1748:Hepacam UTSW 9 37383893 missense possibly damaging 0.90
R4932:Hepacam UTSW 9 37381764 missense probably damaging 1.00
R5587:Hepacam UTSW 9 37384684 missense probably damaging 0.99
R5738:Hepacam UTSW 9 37383425 missense possibly damaging 0.83
R5809:Hepacam UTSW 9 37384805 missense possibly damaging 0.49
R6017:Hepacam UTSW 9 37380760 missense probably benign 0.00
R6825:Hepacam UTSW 9 37367680 missense possibly damaging 0.67
R7420:Hepacam UTSW 9 37380709 missense probably benign 0.00
R7825:Hepacam UTSW 9 37384768 missense probably benign 0.03
R8140:Hepacam UTSW 9 37383871 missense probably benign
R8513:Hepacam UTSW 9 37380634 missense probably benign 0.01
R8547:Hepacam UTSW 9 37367753 missense probably benign 0.12
R8746:Hepacam UTSW 9 37381734 missense probably damaging 1.00
R9169:Hepacam UTSW 9 37382397 missense probably damaging 1.00
R9196:Hepacam UTSW 9 37367756 missense probably benign 0.00
X0024:Hepacam UTSW 9 37381600 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GAGCCAGATGAAAACCCTGC -3'
(R):5'- AGGCCACGATCTCCTTTCAC -3'

Sequencing Primer
(F):5'- AGATGAAAACCCTGCTACAGAG -3'
(R):5'- CAGAGGCATCAGGACTTCTCAG -3'
Posted On 2020-10-20