Incidental Mutation 'R8437:Hepacam'
ID654050
Institutional Source Beutler Lab
Gene Symbol Hepacam
Ensembl Gene ENSMUSG00000046240
Gene Namehepatocyte cell adhesion molecule
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8437 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37367351-37386575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37384710 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 386 (S386P)
Ref Sequence ENSEMBL: ENSMUSP00000054105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051839] [ENSMUST00000215951]
Predicted Effect probably damaging
Transcript: ENSMUST00000051839
AA Change: S386P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000054105
Gene: ENSMUSG00000046240
AA Change: S386P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IG 40 142 1e-3 SMART
IGc2 159 224 1.48e-6 SMART
transmembrane domain 241 263 N/A INTRINSIC
low complexity region 264 274 N/A INTRINSIC
low complexity region 337 356 N/A INTRINSIC
low complexity region 358 372 N/A INTRINSIC
low complexity region 379 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215951
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein that localizes to the cytoplasmic side of the cell membrane. The encoded protein acts as a homodimer and is involved in cell motility and cell-matrix interactions. The expression of this gene is downregulated or undetectable in many cancer cell lines, so this may be a tumor suppressor gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele display myelin vacuolization that progresses with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Hepacam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Hepacam APN 9 37380616 missense probably damaging 1.00
R0924:Hepacam UTSW 9 37383928 splice site probably benign
R1659:Hepacam UTSW 9 37380658 missense probably benign 0.08
R1748:Hepacam UTSW 9 37383893 missense possibly damaging 0.90
R4932:Hepacam UTSW 9 37381764 missense probably damaging 1.00
R5587:Hepacam UTSW 9 37384684 missense probably damaging 0.99
R5738:Hepacam UTSW 9 37383425 missense possibly damaging 0.83
R5809:Hepacam UTSW 9 37384805 missense possibly damaging 0.49
R6017:Hepacam UTSW 9 37380760 missense probably benign 0.00
R6825:Hepacam UTSW 9 37367680 missense possibly damaging 0.67
R7420:Hepacam UTSW 9 37380709 missense probably benign 0.00
R7825:Hepacam UTSW 9 37384768 missense probably benign 0.03
R8140:Hepacam UTSW 9 37383871 missense probably benign
R8513:Hepacam UTSW 9 37380634 missense probably benign 0.01
R8547:Hepacam UTSW 9 37367753 missense probably benign 0.12
R8746:Hepacam UTSW 9 37381734 missense probably damaging 1.00
X0024:Hepacam UTSW 9 37381600 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GAGCCAGATGAAAACCCTGC -3'
(R):5'- AGGCCACGATCTCCTTTCAC -3'

Sequencing Primer
(F):5'- AGATGAAAACCCTGCTACAGAG -3'
(R):5'- CAGAGGCATCAGGACTTCTCAG -3'
Posted On2020-10-20