Incidental Mutation 'R8437:Msl2'
ID654052
Institutional Source Beutler Lab
Gene Symbol Msl2
Ensembl Gene ENSMUSG00000066415
Gene NameMSL complex subunit 2
SynonymsMsl2l1, Rnf184
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R8437 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location101074101-101104800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101100968 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 180 (S180R)
Ref Sequence ENSEMBL: ENSMUSP00000082270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066773] [ENSMUST00000075941] [ENSMUST00000085177] [ENSMUST00000189616]
Predicted Effect probably benign
Transcript: ENSMUST00000066773
SMART Domains Protein: ENSMUSP00000069688
Gene: ENSMUSG00000043154

DomainStartEndE-ValueType
Blast:EFh 140 169 1e-9 BLAST
Pfam:EF-hand_7 282 380 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075941
SMART Domains Protein: ENSMUSP00000075327
Gene: ENSMUSG00000043154

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
Blast:EFh 760 789 1e-9 BLAST
Pfam:EF-hand_7 902 1000 2.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085177
AA Change: S180R

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082270
Gene: ENSMUSG00000066415
AA Change: S180R

DomainStartEndE-ValueType
Pfam:zf-RING_10 42 111 2.8e-36 PFAM
low complexity region 265 281 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
CXC 457 504 1.6e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189616
SMART Domains Protein: ENSMUSP00000139396
Gene: ENSMUSG00000066415

DomainStartEndE-ValueType
PDB:4B86|L 1 47 2e-28 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Msl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Msl2 APN 9 101101070 missense probably benign 0.13
IGL02496:Msl2 APN 9 101100655 missense possibly damaging 0.93
IGL02798:Msl2 APN 9 101075377 missense probably benign 0.06
IGL03235:Msl2 APN 9 101100768 missense probably benign 0.03
anguished UTSW 9 101101975 missense possibly damaging 0.66
Appalled UTSW 9 101100843 missense probably benign
Crestfallen UTSW 9 101101091 nonsense probably null
R0497:Msl2 UTSW 9 101101294 missense probably benign 0.00
R1288:Msl2 UTSW 9 101102109 missense probably benign 0.01
R2015:Msl2 UTSW 9 101075251 start gained probably benign
R2038:Msl2 UTSW 9 101101984 missense probably damaging 1.00
R2238:Msl2 UTSW 9 101101370 missense probably benign 0.41
R4393:Msl2 UTSW 9 101101477 missense probably damaging 1.00
R4827:Msl2 UTSW 9 101102151 missense probably benign 0.00
R5290:Msl2 UTSW 9 101101407 splice site probably null
R5567:Msl2 UTSW 9 101101737 missense possibly damaging 0.67
R5934:Msl2 UTSW 9 101101818 missense probably damaging 1.00
R5940:Msl2 UTSW 9 101101091 nonsense probably null
R6339:Msl2 UTSW 9 101101750 missense probably benign
R6736:Msl2 UTSW 9 101101002 missense probably damaging 0.99
R6950:Msl2 UTSW 9 101101975 missense possibly damaging 0.66
R6971:Msl2 UTSW 9 101100843 missense probably benign
R7022:Msl2 UTSW 9 101075282 missense possibly damaging 0.91
R7408:Msl2 UTSW 9 101102117 missense probably benign 0.08
R7955:Msl2 UTSW 9 101102155 missense possibly damaging 0.69
R8069:Msl2 UTSW 9 101100960 missense probably benign
R8281:Msl2 UTSW 9 101101695 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CACTGGCACGGGATATAATAGAAGC -3'
(R):5'- AGCACAAGTCAGTGGCTACC -3'

Sequencing Primer
(F):5'- ATAGAAGCAGTTGACTGTTCTTCTG -3'
(R):5'- ACAAGTCAGTGGCTACCGTGTC -3'
Posted On2020-10-20