Incidental Mutation 'R8437:Nbas'
ID 654057
Institutional Source Beutler Lab
Gene Symbol Nbas
Ensembl Gene ENSMUSG00000020576
Gene Name neuroblastoma amplified sequence
Synonyms 4933425L03Rik
MMRRC Submission 067901-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8437 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 13319134-13633812 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13616251 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2263 (V2263A)
Ref Sequence ENSEMBL: ENSMUSP00000036082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042953]
AlphaFold E9Q411
Predicted Effect possibly damaging
Transcript: ENSMUST00000042953
AA Change: V2263A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036082
Gene: ENSMUSG00000020576
AA Change: V2263A

DomainStartEndE-ValueType
Pfam:Nbas_N 89 370 4.7e-171 PFAM
low complexity region 463 475 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
Pfam:Sec39 725 1375 3.8e-34 PFAM
low complexity region 1392 1404 N/A INTRINSIC
low complexity region 1549 1566 N/A INTRINSIC
low complexity region 2226 2252 N/A INTRINSIC
low complexity region 2275 2285 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]
Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 78,998,178 (GRCm39) Y237H probably damaging Het
Adprh T C 16: 38,266,449 (GRCm39) E231G probably benign Het
Anks6 T C 4: 47,030,705 (GRCm39) S631G probably benign Het
Bpifa5 T A 2: 154,007,526 (GRCm39) L156H probably damaging Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
C8b T C 4: 104,644,040 (GRCm39) Y236H probably damaging Het
Celf2 C T 2: 6,551,956 (GRCm39) G508S probably damaging Het
Clca3a1 T C 3: 144,710,822 (GRCm39) T794A probably benign Het
Col27a1 T A 4: 63,237,701 (GRCm39) probably benign Het
Cyp2j12 C T 4: 95,987,899 (GRCm39) C497Y probably damaging Het
Dnmt3l T C 10: 77,888,602 (GRCm39) I168T possibly damaging Het
Dtna C T 18: 23,723,398 (GRCm39) Q201* probably null Het
Fetub T C 16: 22,752,985 (GRCm39) S146P possibly damaging Het
Gak T G 5: 108,757,272 (GRCm39) E242D probably benign Het
Gfpt2 T A 11: 49,695,694 (GRCm39) probably benign Het
Ginm1 C T 10: 7,646,130 (GRCm39) C290Y probably benign Het
Hepacam T C 9: 37,296,006 (GRCm39) S386P probably damaging Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Hnrnpa3 T G 2: 75,493,019 (GRCm39) S220A unknown Het
Hydin A G 8: 111,189,367 (GRCm39) E1257G probably damaging Het
Ier3ip1 C T 18: 77,017,874 (GRCm39) A18V probably damaging Het
Ift140 T A 17: 25,313,651 (GRCm39) C1361S probably damaging Het
Il16 T C 7: 83,301,351 (GRCm39) Q955R probably damaging Het
Itpr3 T G 17: 27,326,277 (GRCm39) M1349R probably damaging Het
Kcnk4 C T 19: 6,903,602 (GRCm39) V316I probably benign Het
Marchf6 A G 15: 31,482,695 (GRCm39) I501T possibly damaging Het
Msl2 T A 9: 100,978,167 (GRCm39) S180R probably benign Het
Muc16 C T 9: 18,569,220 (GRCm39) V1100I unknown Het
Or6b2 C T 1: 92,408,187 (GRCm39) S52N probably benign Het
Or7g33 C T 9: 19,448,833 (GRCm39) R131H probably benign Het
Pdilt T G 7: 119,114,109 (GRCm39) I130L possibly damaging Het
Phldb3 A G 7: 24,328,375 (GRCm39) T640A probably damaging Het
Pole2 G C 12: 69,250,961 (GRCm39) Y467* probably null Het
Pxdn C T 12: 30,052,043 (GRCm39) T740M probably damaging Het
Rabac1 T C 7: 24,671,672 (GRCm39) I83V probably damaging Het
Rrp7a T C 15: 83,001,773 (GRCm39) Q245R probably damaging Het
Sae1 A G 7: 16,104,279 (GRCm39) V110A probably damaging Het
Sema3c G T 5: 17,867,936 (GRCm39) V116F probably damaging Het
Serpina3i A G 12: 104,231,963 (GRCm39) Y200C probably damaging Het
Slc25a45 C T 19: 5,930,135 (GRCm39) T35M probably benign Het
Speer4b C T 5: 27,703,818 (GRCm39) R107Q probably benign Het
Sycp2 T C 2: 178,006,651 (GRCm39) T843A probably damaging Het
Tecta T A 9: 42,243,856 (GRCm39) I2004F probably damaging Het
Tma16 T C 8: 66,929,448 (GRCm39) D182G possibly damaging Het
Topaz1 T A 9: 122,610,427 (GRCm39) Y1167* probably null Het
Uck1 C A 2: 32,150,153 (GRCm39) probably benign Het
Usp25 A G 16: 76,830,800 (GRCm39) T19A probably damaging Het
Vpreb1b G A 16: 17,798,753 (GRCm39) G80S probably damaging Het
Wdfy4 A G 14: 32,798,332 (GRCm39) C2025R Het
Zyg11a T A 4: 108,075,103 (GRCm39) H6L probably damaging Het
Other mutations in Nbas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Nbas APN 12 13,503,076 (GRCm39) missense probably benign 0.19
IGL00712:Nbas APN 12 13,412,626 (GRCm39) splice site probably benign
IGL00808:Nbas APN 12 13,616,121 (GRCm39) splice site probably benign
IGL00915:Nbas APN 12 13,424,753 (GRCm39) nonsense probably null
IGL00923:Nbas APN 12 13,386,285 (GRCm39) missense possibly damaging 0.46
IGL01152:Nbas APN 12 13,410,959 (GRCm39) missense probably damaging 1.00
IGL01633:Nbas APN 12 13,533,898 (GRCm39) missense probably damaging 1.00
IGL01672:Nbas APN 12 13,429,650 (GRCm39) missense possibly damaging 0.63
IGL01799:Nbas APN 12 13,374,401 (GRCm39) splice site probably benign
IGL01812:Nbas APN 12 13,503,504 (GRCm39) missense probably damaging 1.00
IGL01934:Nbas APN 12 13,339,880 (GRCm39) splice site probably benign
IGL02093:Nbas APN 12 13,610,963 (GRCm39) missense probably benign 0.00
IGL02115:Nbas APN 12 13,367,693 (GRCm39) splice site probably benign
IGL02175:Nbas APN 12 13,616,260 (GRCm39) critical splice donor site probably null
IGL02268:Nbas APN 12 13,455,398 (GRCm39) missense possibly damaging 0.94
IGL02483:Nbas APN 12 13,374,295 (GRCm39) missense probably damaging 1.00
IGL02539:Nbas APN 12 13,322,704 (GRCm39) splice site probably benign
IGL02557:Nbas APN 12 13,411,029 (GRCm39) missense probably damaging 1.00
IGL02815:Nbas APN 12 13,360,267 (GRCm39) missense probably damaging 1.00
IGL02951:Nbas APN 12 13,412,542 (GRCm39) missense probably benign
IGL03131:Nbas APN 12 13,329,417 (GRCm39) missense probably benign 0.03
IGL03214:Nbas APN 12 13,381,111 (GRCm39) splice site probably benign
IGL03308:Nbas APN 12 13,374,349 (GRCm39) missense possibly damaging 0.93
IGL03368:Nbas APN 12 13,378,452 (GRCm39) missense probably benign 0.08
IGL03372:Nbas APN 12 13,584,473 (GRCm39) missense probably damaging 1.00
IGL03391:Nbas APN 12 13,533,750 (GRCm39) missense probably benign 0.28
medvedev UTSW 12 13,584,578 (GRCm39) critical splice donor site probably null
oligarchs UTSW 12 13,570,751 (GRCm39) missense possibly damaging 0.75
putin UTSW 12 13,371,756 (GRCm39) missense probably damaging 1.00
1mM(1):Nbas UTSW 12 13,338,729 (GRCm39) missense probably damaging 1.00
R0057:Nbas UTSW 12 13,440,958 (GRCm39) missense probably benign 0.00
R0076:Nbas UTSW 12 13,374,337 (GRCm39) missense probably damaging 1.00
R0153:Nbas UTSW 12 13,323,877 (GRCm39) splice site probably benign
R0371:Nbas UTSW 12 13,381,096 (GRCm39) missense probably damaging 0.97
R0449:Nbas UTSW 12 13,569,109 (GRCm39) missense probably benign 0.18
R0791:Nbas UTSW 12 13,532,634 (GRCm39) missense probably benign 0.28
R0931:Nbas UTSW 12 13,381,115 (GRCm39) splice site probably benign
R1236:Nbas UTSW 12 13,319,242 (GRCm39) missense probably damaging 1.00
R1371:Nbas UTSW 12 13,532,379 (GRCm39) splice site probably benign
R1567:Nbas UTSW 12 13,335,279 (GRCm39) missense possibly damaging 0.70
R1587:Nbas UTSW 12 13,608,686 (GRCm39) missense probably benign
R1719:Nbas UTSW 12 13,610,978 (GRCm39) critical splice donor site probably null
R1747:Nbas UTSW 12 13,385,899 (GRCm39) missense probably benign 0.00
R1777:Nbas UTSW 12 13,563,563 (GRCm39) missense probably benign 0.16
R1848:Nbas UTSW 12 13,463,598 (GRCm39) missense probably damaging 0.97
R1856:Nbas UTSW 12 13,524,230 (GRCm39) missense possibly damaging 0.56
R1891:Nbas UTSW 12 13,440,973 (GRCm39) missense possibly damaging 0.92
R1911:Nbas UTSW 12 13,616,145 (GRCm39) missense probably benign
R1912:Nbas UTSW 12 13,616,145 (GRCm39) missense probably benign
R2006:Nbas UTSW 12 13,464,742 (GRCm39) splice site probably null
R2054:Nbas UTSW 12 13,524,207 (GRCm39) missense probably benign 0.36
R2065:Nbas UTSW 12 13,616,158 (GRCm39) missense probably damaging 1.00
R2089:Nbas UTSW 12 13,411,046 (GRCm39) missense probably benign 0.03
R2091:Nbas UTSW 12 13,411,046 (GRCm39) missense probably benign 0.03
R2091:Nbas UTSW 12 13,411,046 (GRCm39) missense probably benign 0.03
R2156:Nbas UTSW 12 13,491,510 (GRCm39) missense probably damaging 1.00
R2164:Nbas UTSW 12 13,380,647 (GRCm39) missense possibly damaging 0.74
R2339:Nbas UTSW 12 13,412,593 (GRCm39) missense probably benign 0.12
R2398:Nbas UTSW 12 13,482,946 (GRCm39) missense probably damaging 0.99
R3806:Nbas UTSW 12 13,532,505 (GRCm39) missense probably damaging 1.00
R3855:Nbas UTSW 12 13,329,415 (GRCm39) missense possibly damaging 0.50
R4019:Nbas UTSW 12 13,532,520 (GRCm39) missense probably damaging 1.00
R4083:Nbas UTSW 12 13,524,192 (GRCm39) missense probably damaging 0.96
R4201:Nbas UTSW 12 13,424,827 (GRCm39) missense probably benign 0.00
R4231:Nbas UTSW 12 13,443,344 (GRCm39) missense probably damaging 0.98
R4552:Nbas UTSW 12 13,385,938 (GRCm39) critical splice donor site probably null
R4560:Nbas UTSW 12 13,633,528 (GRCm39) missense probably benign 0.00
R4728:Nbas UTSW 12 13,338,740 (GRCm39) missense probably damaging 0.98
R4752:Nbas UTSW 12 13,532,538 (GRCm39) missense possibly damaging 0.92
R4832:Nbas UTSW 12 13,533,740 (GRCm39) missense probably benign 0.00
R4874:Nbas UTSW 12 13,371,756 (GRCm39) missense probably damaging 1.00
R4988:Nbas UTSW 12 13,458,266 (GRCm39) missense probably benign 0.45
R5020:Nbas UTSW 12 13,424,713 (GRCm39) missense probably damaging 0.99
R5079:Nbas UTSW 12 13,424,712 (GRCm39) missense probably damaging 1.00
R5129:Nbas UTSW 12 13,440,961 (GRCm39) missense probably damaging 1.00
R5239:Nbas UTSW 12 13,491,519 (GRCm39) missense probably benign 0.31
R5299:Nbas UTSW 12 13,491,926 (GRCm39) nonsense probably null
R5351:Nbas UTSW 12 13,610,850 (GRCm39) missense probably damaging 1.00
R5389:Nbas UTSW 12 13,584,578 (GRCm39) critical splice donor site probably null
R5436:Nbas UTSW 12 13,424,812 (GRCm39) missense probably damaging 1.00
R5654:Nbas UTSW 12 13,633,476 (GRCm39) missense probably damaging 1.00
R5690:Nbas UTSW 12 13,386,285 (GRCm39) missense probably damaging 1.00
R5842:Nbas UTSW 12 13,319,267 (GRCm39) critical splice donor site probably null
R5959:Nbas UTSW 12 13,338,802 (GRCm39) missense probably damaging 0.99
R5982:Nbas UTSW 12 13,443,431 (GRCm39) missense probably benign 0.00
R6238:Nbas UTSW 12 13,532,596 (GRCm39) missense probably benign
R6270:Nbas UTSW 12 13,374,294 (GRCm39) missense probably damaging 1.00
R6363:Nbas UTSW 12 13,532,577 (GRCm39) missense probably benign
R6424:Nbas UTSW 12 13,465,734 (GRCm39) critical splice donor site probably null
R6458:Nbas UTSW 12 13,338,750 (GRCm39) missense probably damaging 1.00
R6526:Nbas UTSW 12 13,455,426 (GRCm39) missense probably damaging 1.00
R6654:Nbas UTSW 12 13,533,875 (GRCm39) nonsense probably null
R7085:Nbas UTSW 12 13,335,259 (GRCm39) missense probably damaging 1.00
R7179:Nbas UTSW 12 13,455,398 (GRCm39) missense possibly damaging 0.94
R7197:Nbas UTSW 12 13,570,751 (GRCm39) missense possibly damaging 0.75
R7378:Nbas UTSW 12 13,324,220 (GRCm39) missense probably damaging 1.00
R7393:Nbas UTSW 12 13,443,493 (GRCm39) missense probably damaging 1.00
R7425:Nbas UTSW 12 13,519,881 (GRCm39) missense probably damaging 1.00
R7446:Nbas UTSW 12 13,443,499 (GRCm39) missense probably benign 0.02
R7481:Nbas UTSW 12 13,406,960 (GRCm39) missense probably damaging 0.97
R7535:Nbas UTSW 12 13,329,390 (GRCm39) missense probably damaging 0.97
R7626:Nbas UTSW 12 13,608,661 (GRCm39) missense probably benign 0.00
R7678:Nbas UTSW 12 13,465,662 (GRCm39) missense probably damaging 0.97
R7912:Nbas UTSW 12 13,455,458 (GRCm39) missense possibly damaging 0.91
R7964:Nbas UTSW 12 13,406,896 (GRCm39) missense probably damaging 0.99
R8193:Nbas UTSW 12 13,483,010 (GRCm39) missense probably damaging 1.00
R8325:Nbas UTSW 12 13,338,796 (GRCm39) missense probably damaging 1.00
R8405:Nbas UTSW 12 13,329,394 (GRCm39) missense probably damaging 1.00
R8559:Nbas UTSW 12 13,402,809 (GRCm39) missense probably benign 0.00
R8684:Nbas UTSW 12 13,386,368 (GRCm39) missense probably damaging 1.00
R8826:Nbas UTSW 12 13,402,875 (GRCm39) splice site probably benign
R8921:Nbas UTSW 12 13,463,590 (GRCm39) missense probably benign
R8956:Nbas UTSW 12 13,482,923 (GRCm39) missense possibly damaging 0.51
R9083:Nbas UTSW 12 13,385,856 (GRCm39) missense possibly damaging 0.56
R9172:Nbas UTSW 12 13,424,751 (GRCm39) missense possibly damaging 0.65
R9430:Nbas UTSW 12 13,371,654 (GRCm39) missense probably benign 0.35
R9627:Nbas UTSW 12 13,350,203 (GRCm39) missense possibly damaging 0.76
R9649:Nbas UTSW 12 13,633,417 (GRCm39) missense probably damaging 1.00
RF013:Nbas UTSW 12 13,329,409 (GRCm39) missense possibly damaging 0.54
T0722:Nbas UTSW 12 13,402,809 (GRCm39) missense probably benign 0.00
Z1176:Nbas UTSW 12 13,533,877 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGAGAATCCGAGTAGATTATCCCAC -3'
(R):5'- CCCATGCAACCAAGTGTGTG -3'

Sequencing Primer
(F):5'- TCCGAGTAGATTATCCCACTAGATC -3'
(R):5'- AACCAAGTGTGTGCTGCCTG -3'
Posted On 2020-10-20