Mutagenetix > Incidental Mutation

Incidental Mutation 'R8437:Nbas'

654057

Institutional Source

Beutler Lab

Gene Symbol

Nbas

Ensembl Gene

ENSMUSG00000020576

Gene Name

neuroblastoma amplified sequence

Synonyms

4933425L03Rik

MMRRC Submission

Accession Numbers

Genbank: NM_027706.1; Ensembl: ENSMUST00000042953

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8437 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13269133-13583811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13566250 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2263 (V2263A)

Ref Sequence

ENSEMBL: ENSMUSP00000036082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042953]

AlphaFold

E9Q411

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042953
AA Change: V2263A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000036082
Gene: ENSMUSG00000020576
AA Change: V2263A

Domain	Start	End	E-Value	Type
Pfam:Nbas_N	89	370	4.7e-171	PFAM
low complexity region	463	475	N/A	INTRINSIC
low complexity region	653	667	N/A	INTRINSIC
Pfam:Sec39	725	1375	3.8e-34	PFAM
low complexity region	1392	1404	N/A	INTRINSIC
low complexity region	1549	1566	N/A	INTRINSIC
low complexity region	2226	2252	N/A	INTRINSIC
low complexity region	2275	2285	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]

Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd2	T	C	7: 79,348,430	Y237H	probably damaging	Het
Adprh	T	C	16: 38,446,087	E231G	probably benign	Het
Anks6	T	C	4: 47,030,705	S631G	probably benign	Het
Bpifa5	T	A	2: 154,165,606	L156H	probably damaging	Het
Bsn	G	A	9: 108,111,452	A2367V	probably benign	Het
C8b	T	C	4: 104,786,843	Y236H	probably damaging	Het
Celf2	C	T	2: 6,547,145	G508S	probably damaging	Het
Clca1	T	C	3: 145,005,061	T794A	probably benign	Het
Col27a1	T	A	4: 63,319,464		probably benign	Het
Cyp2j12	C	T	4: 96,099,662	C497Y	probably damaging	Het
Dnmt3l	T	C	10: 78,052,768	I168T	possibly damaging	Het
Dtna	C	T	18: 23,590,341	Q201*	probably null	Het
Fetub	T	C	16: 22,934,235	S146P	possibly damaging	Het
Gak	T	G	5: 108,609,406	E242D	probably benign	Het
Gfpt2	T	A	11: 49,804,867		probably benign	Het
Ginm1	C	T	10: 7,770,366	C290Y	probably benign	Het
Hepacam	T	C	9: 37,384,710	S386P	probably damaging	Het
Hmcn2	C	A	2: 31,391,076	L1867I	probably benign	Het
Hnrnpa3	T	G	2: 75,662,675	S220A	unknown	Het
Hydin	A	G	8: 110,462,735	E1257G	probably damaging	Het
Ier3ip1	C	T	18: 76,930,178	A18V	probably damaging	Het
Ift140	T	A	17: 25,094,677	C1361S	probably damaging	Het
Il16	T	C	7: 83,652,143	Q955R	probably damaging	Het
Itpr3	T	G	17: 27,107,303	M1349R	probably damaging	Het
Kcnk4	C	T	19: 6,926,234	V316I	probably benign	Het
March6	A	G	15: 31,482,549	I501T	possibly damaging	Het
Msl2	T	A	9: 101,100,968	S180R	probably benign	Het
Muc16	C	T	9: 18,657,924	V1100I	unknown	Het
Olfr1416	C	T	1: 92,480,465	S52N	probably benign	Het
Olfr853	C	T	9: 19,537,537	R131H	probably benign	Het
Pdilt	T	G	7: 119,514,886	I130L	possibly damaging	Het
Phldb3	A	G	7: 24,628,950	T640A	probably damaging	Het
Pole2	G	C	12: 69,204,187	Y467*	probably null	Het
Pxdn	C	T	12: 30,002,044	T740M	probably damaging	Het
Rabac1	T	C	7: 24,972,247	I83V	probably damaging	Het
Rrp7a	T	C	15: 83,117,572	Q245R	probably damaging	Het
Sae1	A	G	7: 16,370,354	V110A	probably damaging	Het
Sema3c	G	T	5: 17,662,938	V116F	probably damaging	Het
Serpina3i	A	G	12: 104,265,704	Y200C	probably damaging	Het
Slc25a45	C	T	19: 5,880,107	T35M	probably benign	Het
Speer4b	C	T	5: 27,498,820	R107Q	probably benign	Het
Sycp2	T	C	2: 178,364,858	T843A	probably damaging	Het
Tecta	T	A	9: 42,332,560	I2004F	probably damaging	Het
Tma16	T	C	8: 66,476,796	D182G	possibly damaging	Het
Topaz1	T	A	9: 122,781,362	Y1167*	probably null	Het
Uck1	C	A	2: 32,260,141		probably benign	Het
Usp25	A	G	16: 77,033,912	T19A	probably damaging	Het
Vpreb2	G	A	16: 17,980,889	G80S	probably damaging	Het
Wdfy4	A	G	14: 33,076,375	C2025R		Het
Zyg11a	T	A	4: 108,217,906	H6L	probably damaging	Het

Other mutations in Nbas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Nbas	APN	12	13453075	missense	probably benign	0.19
IGL00712:Nbas	APN	12	13362625	splice site	probably benign
IGL00808:Nbas	APN	12	13566120	splice site	probably benign
IGL00915:Nbas	APN	12	13374752	nonsense	probably null
IGL00923:Nbas	APN	12	13336284	missense	possibly damaging	0.46
IGL01152:Nbas	APN	12	13360958	missense	probably damaging	1.00
IGL01633:Nbas	APN	12	13483897	missense	probably damaging	1.00
IGL01672:Nbas	APN	12	13379649	missense	possibly damaging	0.63
IGL01799:Nbas	APN	12	13324400	splice site	probably benign
IGL01812:Nbas	APN	12	13453503	missense	probably damaging	1.00
IGL01934:Nbas	APN	12	13289879	splice site	probably benign
IGL02093:Nbas	APN	12	13560962	missense	probably benign	0.00
IGL02115:Nbas	APN	12	13317692	splice site	probably benign
IGL02175:Nbas	APN	12	13566259	critical splice donor site	probably null
IGL02268:Nbas	APN	12	13405397	missense	possibly damaging	0.94
IGL02483:Nbas	APN	12	13324294	missense	probably damaging	1.00
IGL02539:Nbas	APN	12	13272703	splice site	probably benign
IGL02557:Nbas	APN	12	13361028	missense	probably damaging	1.00
IGL02815:Nbas	APN	12	13310266	missense	probably damaging	1.00
IGL02951:Nbas	APN	12	13362541	missense	probably benign
IGL03131:Nbas	APN	12	13279416	missense	probably benign	0.03
IGL03214:Nbas	APN	12	13331110	splice site	probably benign
IGL03308:Nbas	APN	12	13324348	missense	possibly damaging	0.93
IGL03368:Nbas	APN	12	13328451	missense	probably benign	0.08
IGL03372:Nbas	APN	12	13534472	missense	probably damaging	1.00
IGL03391:Nbas	APN	12	13483749	missense	probably benign	0.28
medvedev	UTSW	12	13534577	critical splice donor site	probably null
oligarchs	UTSW	12	13520750	missense	possibly damaging	0.75
putin	UTSW	12	13321755	missense	probably damaging	1.00
1mM(1):Nbas	UTSW	12	13288728	missense	probably damaging	1.00
R0057:Nbas	UTSW	12	13390957	missense	probably benign	0.00
R0076:Nbas	UTSW	12	13324336	missense	probably damaging	1.00
R0153:Nbas	UTSW	12	13273876	splice site	probably benign
R0371:Nbas	UTSW	12	13331095	missense	probably damaging	0.97
R0449:Nbas	UTSW	12	13519108	missense	probably benign	0.18
R0791:Nbas	UTSW	12	13482633	missense	probably benign	0.28
R0931:Nbas	UTSW	12	13331114	splice site	probably benign
R1236:Nbas	UTSW	12	13269241	missense	probably damaging	1.00
R1371:Nbas	UTSW	12	13482378	splice site	probably benign
R1567:Nbas	UTSW	12	13285278	missense	possibly damaging	0.70
R1587:Nbas	UTSW	12	13558685	missense	probably benign
R1719:Nbas	UTSW	12	13560977	critical splice donor site	probably null
R1747:Nbas	UTSW	12	13335898	missense	probably benign	0.00
R1777:Nbas	UTSW	12	13513562	missense	probably benign	0.16
R1848:Nbas	UTSW	12	13413597	missense	probably damaging	0.97
R1856:Nbas	UTSW	12	13474229	missense	possibly damaging	0.56
R1891:Nbas	UTSW	12	13390972	missense	possibly damaging	0.92
R1911:Nbas	UTSW	12	13566144	missense	probably benign
R1912:Nbas	UTSW	12	13566144	missense	probably benign
R2006:Nbas	UTSW	12	13414741	splice site	probably null
R2054:Nbas	UTSW	12	13474206	missense	probably benign	0.36
R2065:Nbas	UTSW	12	13566157	missense	probably damaging	1.00
R2089:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2091:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2091:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2156:Nbas	UTSW	12	13441509	missense	probably damaging	1.00
R2164:Nbas	UTSW	12	13330646	missense	possibly damaging	0.74
R2339:Nbas	UTSW	12	13362592	missense	probably benign	0.12
R2398:Nbas	UTSW	12	13432945	missense	probably damaging	0.99
R3806:Nbas	UTSW	12	13482504	missense	probably damaging	1.00
R3855:Nbas	UTSW	12	13279414	missense	possibly damaging	0.50
R4019:Nbas	UTSW	12	13482519	missense	probably damaging	1.00
R4083:Nbas	UTSW	12	13474191	missense	probably damaging	0.96
R4201:Nbas	UTSW	12	13374826	missense	probably benign	0.00
R4231:Nbas	UTSW	12	13393343	missense	probably damaging	0.98
R4552:Nbas	UTSW	12	13335937	critical splice donor site	probably null
R4560:Nbas	UTSW	12	13583527	missense	probably benign	0.00
R4728:Nbas	UTSW	12	13288739	missense	probably damaging	0.98
R4752:Nbas	UTSW	12	13482537	missense	possibly damaging	0.92
R4832:Nbas	UTSW	12	13483739	missense	probably benign	0.00
R4874:Nbas	UTSW	12	13321755	missense	probably damaging	1.00
R4988:Nbas	UTSW	12	13408265	missense	probably benign	0.45
R5020:Nbas	UTSW	12	13374712	missense	probably damaging	0.99
R5079:Nbas	UTSW	12	13374711	missense	probably damaging	1.00
R5129:Nbas	UTSW	12	13390960	missense	probably damaging	1.00
R5239:Nbas	UTSW	12	13441518	missense	probably benign	0.31
R5299:Nbas	UTSW	12	13441925	nonsense	probably null
R5351:Nbas	UTSW	12	13560849	missense	probably damaging	1.00
R5389:Nbas	UTSW	12	13534577	critical splice donor site	probably null
R5436:Nbas	UTSW	12	13374811	missense	probably damaging	1.00
R5654:Nbas	UTSW	12	13583475	missense	probably damaging	1.00
R5690:Nbas	UTSW	12	13336284	missense	probably damaging	1.00
R5842:Nbas	UTSW	12	13269266	critical splice donor site	probably null
R5959:Nbas	UTSW	12	13288801	missense	probably damaging	0.99
R5982:Nbas	UTSW	12	13393430	missense	probably benign	0.00
R6238:Nbas	UTSW	12	13482595	missense	probably benign
R6270:Nbas	UTSW	12	13324293	missense	probably damaging	1.00
R6363:Nbas	UTSW	12	13482576	missense	probably benign
R6424:Nbas	UTSW	12	13415733	critical splice donor site	probably null
R6458:Nbas	UTSW	12	13288749	missense	probably damaging	1.00
R6526:Nbas	UTSW	12	13405425	missense	probably damaging	1.00
R6654:Nbas	UTSW	12	13483874	nonsense	probably null
R7085:Nbas	UTSW	12	13285258	missense	probably damaging	1.00
R7179:Nbas	UTSW	12	13405397	missense	possibly damaging	0.94
R7197:Nbas	UTSW	12	13520750	missense	possibly damaging	0.75
R7378:Nbas	UTSW	12	13274219	missense	probably damaging	1.00
R7393:Nbas	UTSW	12	13393492	missense	probably damaging	1.00
R7425:Nbas	UTSW	12	13469880	missense	probably damaging	1.00
R7446:Nbas	UTSW	12	13393498	missense	probably benign	0.02
R7481:Nbas	UTSW	12	13356959	missense	probably damaging	0.97
R7535:Nbas	UTSW	12	13279389	missense	probably damaging	0.97
R7626:Nbas	UTSW	12	13558660	missense	probably benign	0.00
R7678:Nbas	UTSW	12	13415661	missense	probably damaging	0.97
R7912:Nbas	UTSW	12	13405457	missense	possibly damaging	0.91
R7964:Nbas	UTSW	12	13356895	missense	probably damaging	0.99
R8193:Nbas	UTSW	12	13433009	missense	probably damaging	1.00
R8325:Nbas	UTSW	12	13288795	missense	probably damaging	1.00
R8405:Nbas	UTSW	12	13279393	missense	probably damaging	1.00
R8559:Nbas	UTSW	12	13352808	missense	probably benign	0.00
R8684:Nbas	UTSW	12	13336367	missense	probably damaging	1.00
R8826:Nbas	UTSW	12	13352874	splice site	probably benign
R8921:Nbas	UTSW	12	13413589	missense	probably benign
R8956:Nbas	UTSW	12	13432922	missense	possibly damaging	0.51
R9083:Nbas	UTSW	12	13335855	missense	possibly damaging	0.56
R9172:Nbas	UTSW	12	13374750	missense	possibly damaging	0.65
R9430:Nbas	UTSW	12	13321653	missense	probably benign	0.35
R9627:Nbas	UTSW	12	13300202	missense	possibly damaging	0.76
R9649:Nbas	UTSW	12	13583416	missense	probably damaging	1.00
RF013:Nbas	UTSW	12	13279408	missense	possibly damaging	0.54
T0722:Nbas	UTSW	12	13352808	missense	probably benign	0.00
Z1176:Nbas	UTSW	12	13483876	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGAGAATCCGAGTAGATTATCCCAC -3'
(R):5'- CCCATGCAACCAAGTGTGTG -3'

Sequencing Primer
(F):5'- TCCGAGTAGATTATCCCACTAGATC -3'
(R):5'- AACCAAGTGTGTGCTGCCTG -3'

Posted On

2020-10-20