Mutagenetix > Incidental Mutations

Incidental Mutation 'R8437:Pxdn'

654058

Institutional Source

Beutler Lab

Gene Symbol

Pxdn

Ensembl Gene

ENSMUSG00000020674

Gene Name

peroxidasin

Synonyms

VPO1, 2310075M15Rik

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.636) question?

Stock #

R8437 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

29937608-30017658 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30002044 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 740 (T740M)

Ref Sequence

ENSEMBL: ENSMUSP00000113703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]

Predicted Effect

probably damaging
Transcript: ENSMUST00000122328
AA Change: T740M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: T740M

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
LRRNT	32	63	2.52e-1	SMART
LRR	62	81	4.09e1	SMART
LRR_TYP	82	105	3.69e-4	SMART
LRR_TYP	106	129	1.45e-2	SMART
LRR_TYP	130	153	8.02e-5	SMART
LRR_TYP	154	177	1.06e-4	SMART
LRRCT	189	241	3.97e-5	SMART
IGc2	255	321	1.59e-15	SMART
IGc2	351	416	3.96e-16	SMART
IGc2	442	506	2.96e-15	SMART
IGc2	534	598	1.2e-15	SMART
Pfam:An_peroxidase	738	1286	1.1e-196	PFAM
VWC	1411	1466	8.8e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000220271
AA Change: T560M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd2	T	C	7: 79,348,430	Y237H	probably damaging	Het
Adprh	T	C	16: 38,446,087	E231G	probably benign	Het
Anks6	T	C	4: 47,030,705	S631G	probably benign	Het
Bpifa5	T	A	2: 154,165,606	L156H	probably damaging	Het
Bsn	G	A	9: 108,111,452	A2367V	probably benign	Het
C8b	T	C	4: 104,786,843	Y236H	probably damaging	Het
Celf2	C	T	2: 6,547,145	G508S	probably damaging	Het
Clca1	T	C	3: 145,005,061	T794A	probably benign	Het
Col27a1	T	A	4: 63,319,464		probably benign	Het
Cyp2j12	C	T	4: 96,099,662	C497Y	probably damaging	Het
Dnmt3l	T	C	10: 78,052,768	I168T	possibly damaging	Het
Dtna	C	T	18: 23,590,341	Q201*	probably null	Het
Fetub	T	C	16: 22,934,235	S146P	possibly damaging	Het
Gak	T	G	5: 108,609,406	E242D	probably benign	Het
Gfpt2	T	A	11: 49,804,867		probably benign	Het
Ginm1	C	T	10: 7,770,366	C290Y	probably benign	Het
Hepacam	T	C	9: 37,384,710	S386P	probably damaging	Het
Hmcn2	C	A	2: 31,391,076	L1867I	probably benign	Het
Hnrnpa3	T	G	2: 75,662,675	S220A	unknown	Het
Hydin	A	G	8: 110,462,735	E1257G	probably damaging	Het
Ier3ip1	C	T	18: 76,930,178	A18V	probably damaging	Het
Ift140	T	A	17: 25,094,677	C1361S	probably damaging	Het
Il16	T	C	7: 83,652,143	Q955R	probably damaging	Het
Itpr3	T	G	17: 27,107,303	M1349R	probably damaging	Het
Kcnk4	C	T	19: 6,926,234	V316I	probably benign	Het
March6	A	G	15: 31,482,549	I501T	possibly damaging	Het
Msl2	T	A	9: 101,100,968	S180R	probably benign	Het
Muc16	C	T	9: 18,657,924	V1100I	unknown	Het
Nbas	T	C	12: 13,566,250	V2263A	possibly damaging	Het
Olfr1416	C	T	1: 92,480,465	S52N	probably benign	Het
Olfr853	C	T	9: 19,537,537	R131H	probably benign	Het
Pdilt	T	G	7: 119,514,886	I130L	possibly damaging	Het
Phldb3	A	G	7: 24,628,950	T640A	probably damaging	Het
Pole2	G	C	12: 69,204,187	Y467*	probably null	Het
Rabac1	T	C	7: 24,972,247	I83V	probably damaging	Het
Rrp7a	T	C	15: 83,117,572	Q245R	probably damaging	Het
Sae1	A	G	7: 16,370,354	V110A	probably damaging	Het
Sema3c	G	T	5: 17,662,938	V116F	probably damaging	Het
Serpina3i	A	G	12: 104,265,704	Y200C	probably damaging	Het
Slc25a45	C	T	19: 5,880,107	T35M	probably benign	Het
Speer4b	C	T	5: 27,498,820	R107Q	probably benign	Het
Sycp2	T	C	2: 178,364,858	T843A	probably damaging	Het
Tecta	T	A	9: 42,332,560	I2004F	probably damaging	Het
Tma16	T	C	8: 66,476,796	D182G	possibly damaging	Het
Topaz1	T	A	9: 122,781,362	Y1167*	probably null	Het
Uck1	C	A	2: 32,260,141		probably benign	Het
Usp25	A	G	16: 77,033,912	T19A	probably damaging	Het
Vpreb2	G	A	16: 17,980,889	G80S	probably damaging	Het
Wdfy4	A	G	14: 33,076,375	C2025R		Het
Zyg11a	T	A	4: 108,217,906	H6L	probably damaging	Het

Other mutations in Pxdn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Pxdn	APN	12	29987099	missense	probably damaging	1.00
IGL01152:Pxdn	APN	12	30001937	missense	probably damaging	0.99
IGL01286:Pxdn	APN	12	29982754	missense	probably benign	0.04
IGL01323:Pxdn	APN	12	29987137	missense	probably benign	0.00
IGL01338:Pxdn	APN	12	30002797	missense	probably damaging	1.00
IGL01341:Pxdn	APN	12	30002487	missense	probably damaging	1.00
IGL01401:Pxdn	APN	12	30001984	missense	probably damaging	1.00
IGL01580:Pxdn	APN	12	29984493	missense	probably benign	0.18
IGL01650:Pxdn	APN	12	30002401	missense	probably benign	0.01
IGL01679:Pxdn	APN	12	29999902	missense	probably damaging	0.97
IGL01866:Pxdn	APN	12	29984571	missense	probably benign	0.02
IGL02354:Pxdn	APN	12	29999189	missense	probably damaging	1.00
IGL02361:Pxdn	APN	12	29999189	missense	probably damaging	1.00
IGL02427:Pxdn	APN	12	29984532	missense	probably damaging	1.00
IGL02955:Pxdn	APN	12	30003157	missense	probably damaging	1.00
IGL03079:Pxdn	APN	12	30002998	missense	probably damaging	0.97
IGL03111:Pxdn	APN	12	29982756	missense	probably damaging	0.99
IGL02988:Pxdn	UTSW	12	30003114	nonsense	probably null
PIT4280001:Pxdn	UTSW	12	29995328	missense	probably damaging	0.99
PIT4469001:Pxdn	UTSW	12	30005829	missense	probably benign	0.00
R0070:Pxdn	UTSW	12	29982727	missense	probably damaging	0.99
R0070:Pxdn	UTSW	12	29982727	missense	probably damaging	0.99
R0086:Pxdn	UTSW	12	30002419	missense	possibly damaging	0.95
R0140:Pxdn	UTSW	12	29982754	missense	probably benign	0.04
R0201:Pxdn	UTSW	12	30002431	missense	possibly damaging	0.79
R0282:Pxdn	UTSW	12	29984440	nonsense	probably null
R0310:Pxdn	UTSW	12	30015529	missense	probably damaging	1.00
R0426:Pxdn	UTSW	12	29987066	missense	possibly damaging	0.89
R0468:Pxdn	UTSW	12	29994486	missense	probably damaging	0.99
R0825:Pxdn	UTSW	12	29984996	splice site	probably benign
R0885:Pxdn	UTSW	12	30003402	missense	probably benign	0.30
R1420:Pxdn	UTSW	12	30002068	missense	probably damaging	1.00
R1588:Pxdn	UTSW	12	30002559	missense	probably damaging	1.00
R2269:Pxdn	UTSW	12	30005775	missense	probably damaging	0.97
R2280:Pxdn	UTSW	12	29984906	missense	probably damaging	0.98
R2504:Pxdn	UTSW	12	30003406	missense	probably damaging	1.00
R2679:Pxdn	UTSW	12	29975569	splice site	probably benign
R3116:Pxdn	UTSW	12	30002307	missense	possibly damaging	0.89
R3607:Pxdn	UTSW	12	29990918	missense	probably benign	0.04
R4033:Pxdn	UTSW	12	30003225	missense	probably benign	0.19
R4576:Pxdn	UTSW	12	30011923	missense	probably benign
R4659:Pxdn	UTSW	12	29994553	missense	probably benign	0.01
R4681:Pxdn	UTSW	12	30012326	missense	probably benign	0.45
R4968:Pxdn	UTSW	12	30000012	missense	probably benign	0.25
R5032:Pxdn	UTSW	12	30003141	missense	probably benign	0.08
R5232:Pxdn	UTSW	12	29990988	missense	probably benign	0.08
R5366:Pxdn	UTSW	12	30002900	missense	probably damaging	1.00
R5504:Pxdn	UTSW	12	30002801	missense	probably damaging	1.00
R5586:Pxdn	UTSW	12	30003142	missense	probably damaging	0.99
R5739:Pxdn	UTSW	12	29982334	missense	probably benign	0.03
R5877:Pxdn	UTSW	12	30003046	missense	probably damaging	1.00
R6167:Pxdn	UTSW	12	29974001	missense	probably damaging	1.00
R6191:Pxdn	UTSW	12	29982717	missense	possibly damaging	0.94
R6200:Pxdn	UTSW	12	30003112	missense	probably damaging	1.00
R6609:Pxdn	UTSW	12	30002941	missense	probably benign	0.00
R6628:Pxdn	UTSW	12	29999918	missense	probably damaging	1.00
R6865:Pxdn	UTSW	12	30014583	splice site	probably null
R6921:Pxdn	UTSW	12	30015505	missense	probably damaging	0.96
R6995:Pxdn	UTSW	12	29995371	missense	possibly damaging	0.95
R7211:Pxdn	UTSW	12	29984904	missense	possibly damaging	0.77
R7220:Pxdn	UTSW	12	29994480	missense	probably benign	0.02
R7347:Pxdn	UTSW	12	30012261	missense	probably benign	0.01
R7402:Pxdn	UTSW	12	30002439	missense	probably damaging	1.00
R7408:Pxdn	UTSW	12	29990945	missense	probably benign	0.29
R7413:Pxdn	UTSW	12	30002928	missense	probably benign	0.00
R7447:Pxdn	UTSW	12	29984927	missense	probably damaging	1.00
R7572:Pxdn	UTSW	12	30006705	missense	probably damaging	1.00
R7708:Pxdn	UTSW	12	30006602	missense	probably damaging	0.99
R7815:Pxdn	UTSW	12	30005825	missense	probably damaging	0.96
R7972:Pxdn	UTSW	12	30006602	missense	probably damaging	0.99
R8097:Pxdn	UTSW	12	30006602	missense	probably damaging	0.99
R8098:Pxdn	UTSW	12	30006602	missense	probably damaging	0.99
R8205:Pxdn	UTSW	12	30006567	missense	probably damaging	1.00
R8262:Pxdn	UTSW	12	29999196	nonsense	probably null
R8335:Pxdn	UTSW	12	30002097	missense	probably damaging	0.99
R8356:Pxdn	UTSW	12	30011890	missense	probably damaging	0.99
R8456:Pxdn	UTSW	12	30011890	missense	probably damaging	0.99
R8709:Pxdn	UTSW	12	30006602	missense	probably damaging	0.99
R8772:Pxdn	UTSW	12	30015464	missense	probably damaging	1.00
Z1177:Pxdn	UTSW	12	29990852	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACTCTGAAGGCAGTGGTCTG -3'
(R):5'- GTGTGTAAACTGCTCATCGGG -3'

Sequencing Primer
(F):5'- GGTCTGCACCATGGCTG -3'
(R):5'- AAACTGCTCATCGGGGGTGATC -3'

Posted On

2020-10-20