Incidental Mutation 'R8437:March6'
ID654062
Institutional Source Beutler Lab
Gene Symbol March6
Ensembl Gene ENSMUSG00000039100
Gene Namemembrane-associated ring finger (C3HC4) 6
SynonymsF830029L24Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R8437 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location31455891-31531053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31482549 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 501 (I501T)
Ref Sequence ENSEMBL: ENSMUSP00000087694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090227]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090227
AA Change: I501T

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087694
Gene: ENSMUSG00000039100
AA Change: I501T

DomainStartEndE-ValueType
RINGv 8 56 1.13e-21 SMART
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
low complexity region 223 259 N/A INTRINSIC
transmembrane domain 290 312 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 420 442 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
transmembrane domain 522 540 N/A INTRINSIC
low complexity region 574 599 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
transmembrane domain 720 742 N/A INTRINSIC
transmembrane domain 762 784 N/A INTRINSIC
transmembrane domain 805 827 N/A INTRINSIC
transmembrane domain 847 866 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated E3 ubiquitin ligases containing RING-CH-type zinc finger motifs. Ubiquitination of type II deiodinase by the encoded protein is an important regulatory step in thyroid hormone signalling. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in March6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:March6 APN 15 31475763 missense probably benign 0.00
IGL00902:March6 APN 15 31484978 missense probably damaging 1.00
IGL02352:March6 APN 15 31509759 missense probably damaging 1.00
IGL02359:March6 APN 15 31509759 missense probably damaging 1.00
IGL02565:March6 APN 15 31490566 splice site probably benign
IGL02735:March6 APN 15 31486120 missense probably benign 0.00
IGL02808:March6 APN 15 31478406 missense probably benign 0.32
IGL03122:March6 APN 15 31478293 critical splice donor site probably null
IGL03235:March6 APN 15 31485995 missense probably damaging 1.00
IGL03238:March6 APN 15 31461941 critical splice donor site probably benign
IGL03263:March6 APN 15 31486362 missense probably benign 0.01
ideation UTSW 15 31482504 missense possibly damaging 0.95
R0003:March6 UTSW 15 31469532 splice site probably benign
R0056:March6 UTSW 15 31467734 missense possibly damaging 0.68
R0115:March6 UTSW 15 31475812 missense probably benign
R0126:March6 UTSW 15 31462005 missense probably benign 0.00
R0148:March6 UTSW 15 31490612 missense probably damaging 0.99
R0744:March6 UTSW 15 31480291 missense probably benign 0.00
R0833:March6 UTSW 15 31480291 missense probably benign 0.00
R1205:March6 UTSW 15 31469673 missense probably benign 0.01
R1339:March6 UTSW 15 31486402 missense probably benign 0.12
R1485:March6 UTSW 15 31498693 missense probably damaging 0.96
R1885:March6 UTSW 15 31502806 missense probably benign 0.00
R1889:March6 UTSW 15 31459193 missense possibly damaging 0.86
R1984:March6 UTSW 15 31469646 missense probably damaging 0.99
R2007:March6 UTSW 15 31461941 critical splice donor site probably null
R2046:March6 UTSW 15 31486434 missense probably benign 0.01
R2135:March6 UTSW 15 31509764 nonsense probably null
R3116:March6 UTSW 15 31486119 missense probably benign 0.00
R3710:March6 UTSW 15 31509826 splice site probably benign
R3715:March6 UTSW 15 31465259 missense probably benign 0.00
R3749:March6 UTSW 15 31462014 missense probably benign 0.00
R3944:March6 UTSW 15 31488814 missense probably benign 0.00
R4327:March6 UTSW 15 31498741 missense probably benign 0.17
R4329:March6 UTSW 15 31498741 missense probably benign 0.17
R5001:March6 UTSW 15 31465322 missense probably damaging 0.98
R5149:March6 UTSW 15 31461994 missense possibly damaging 0.53
R5654:March6 UTSW 15 31485936 missense probably damaging 1.00
R6163:March6 UTSW 15 31465351 missense probably benign
R6172:March6 UTSW 15 31482867 missense possibly damaging 0.86
R6381:March6 UTSW 15 31467692 missense probably benign 0.01
R6888:March6 UTSW 15 31459233 missense probably benign 0.00
R7347:March6 UTSW 15 31486359 missense probably benign 0.00
R8029:March6 UTSW 15 31496002 critical splice donor site probably null
R8316:March6 UTSW 15 31482504 missense possibly damaging 0.95
R8342:March6 UTSW 15 31494116 missense possibly damaging 0.91
R8431:March6 UTSW 15 31505746 nonsense probably null
R8554:March6 UTSW 15 31482830 missense probably damaging 1.00
R8893:March6 UTSW 15 31498704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATAAATGACAGCTTTCCTAAG -3'
(R):5'- TTGTCAGTGGTAAGCAGGTC -3'

Sequencing Primer
(F):5'- GACAGCTTTCCTAAGTTTTAAGAACG -3'
(R):5'- AAAATCAAGGCATGCTACCTATTAG -3'
Posted On2020-10-20