Incidental Mutation 'R8437:Rrp7a'
ID 654063
Institutional Source Beutler Lab
Gene Symbol Rrp7a
Ensembl Gene ENSMUSG00000018040
Gene Name ribosomal RNA processing 7 homolog A (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock # R8437 (G1)
Quality Score 224.009
Status Validated
Chromosome 15
Chromosomal Location 83113433-83122801 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83117572 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 245 (Q245R)
Ref Sequence ENSEMBL: ENSMUSP00000018184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018184] [ENSMUST00000078218] [ENSMUST00000166019] [ENSMUST00000166427] [ENSMUST00000167483]
AlphaFold Q9D1C9
Predicted Effect probably damaging
Transcript: ENSMUST00000018184
AA Change: Q245R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018184
Gene: ENSMUSG00000018040
AA Change: Q245R

DomainStartEndE-ValueType
SCOP:d1l3ka1 56 140 2e-6 SMART
Pfam:RRP7 151 280 8.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078218
SMART Domains Protein: ENSMUSP00000077345
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 28 282 1.4e-10 PFAM
Pfam:Abhydrolase_6 29 295 2.9e-28 PFAM
Pfam:Abhydrolase_1 53 260 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166019
SMART Domains Protein: ENSMUSP00000129142
Gene: ENSMUSG00000018040

DomainStartEndE-ValueType
SCOP:d1l3ka1 71 144 4e-5 SMART
Blast:RRM 75 145 1e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166427
SMART Domains Protein: ENSMUSP00000132686
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Hydrolase_4 33 194 7.4e-11 PFAM
Pfam:Abhydrolase_1 37 299 4e-20 PFAM
Pfam:Abhydrolase_5 38 292 4.4e-10 PFAM
Pfam:Abhydrolase_6 39 305 6.1e-13 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000127001
Gene: ENSMUSG00000018040
AA Change: Q15R

DomainStartEndE-ValueType
Pfam:RRP7 1 51 8.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167483
SMART Domains Protein: ENSMUSP00000128380
Gene: ENSMUSG00000018040

DomainStartEndE-ValueType
SCOP:d1l3ka1 56 90 6e-5 SMART
Blast:RRM 60 114 1e-25 BLAST
low complexity region 122 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169814
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Rrp7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Rrp7a APN 15 83118081 missense probably benign 0.34
IGL02335:Rrp7a APN 15 83122691 missense probably benign 0.00
IGL02524:Rrp7a APN 15 83118178 unclassified probably benign
R4944:Rrp7a UTSW 15 83119809 unclassified probably benign
R6284:Rrp7a UTSW 15 83121860 missense probably damaging 1.00
R7284:Rrp7a UTSW 15 83121870 missense probably damaging 0.96
R7548:Rrp7a UTSW 15 83117670 missense possibly damaging 0.85
R8018:Rrp7a UTSW 15 83116924 missense possibly damaging 0.49
Z1177:Rrp7a UTSW 15 83122138 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCAACAGGGAGAATGTCCTG -3'
(R):5'- TCAACAGCGTCTTCCATGCAG -3'

Sequencing Primer
(F):5'- GAGACTGTCCTCCCTTGTGG -3'
(R):5'- TCTTCCATGCAGGAGGAGG -3'
Posted On 2020-10-20