Incidental Mutation 'R8437:Fetub'
ID654065
Institutional Source Beutler Lab
Gene Symbol Fetub
Ensembl Gene ENSMUSG00000022871
Gene Namefetuin beta
Synonyms2310011O17Rik, D17980
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8437 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location22918334-22939778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22934235 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 146 (S146P)
Ref Sequence ENSEMBL: ENSMUSP00000023587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023587] [ENSMUST00000116625] [ENSMUST00000167399] [ENSMUST00000170805] [ENSMUST00000231768] [ENSMUST00000231880] [ENSMUST00000232097]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023587
AA Change: S146P

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023587
Gene: ENSMUSG00000022871
AA Change: S146P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116625
AA Change: S66P

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112324
Gene: ENSMUSG00000022871
AA Change: S66P

DomainStartEndE-ValueType
Blast:CY 1 61 4e-33 BLAST
CY 73 175 1.77e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167399
AA Change: S146P

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128745
Gene: ENSMUSG00000022871
AA Change: S146P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170805
AA Change: S146P

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128989
Gene: ENSMUSG00000022871
AA Change: S146P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000231768
AA Change: S146P

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231880
AA Change: S66P

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232097
AA Change: S146P

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption, regulation of the insulin and hepatocyte growth factor receptors, and response to systemic inflammation. This protein may be secreted by cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility due to premature hardening of the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Fetub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Fetub APN 16 22935696 missense probably benign 0.29
IGL00843:Fetub APN 16 22929629 splice site probably benign
IGL01450:Fetub APN 16 22929236 missense probably benign 0.01
IGL01522:Fetub APN 16 22929641 start codon destroyed probably null 0.10
IGL02222:Fetub APN 16 22932328 missense probably damaging 1.00
IGL02745:Fetub APN 16 22937926 missense probably damaging 0.99
R0062:Fetub UTSW 16 22929086 intron probably benign
R0310:Fetub UTSW 16 22929756 splice site probably benign
R0508:Fetub UTSW 16 22929295 missense probably benign 0.01
R0604:Fetub UTSW 16 22935660 missense possibly damaging 0.78
R1560:Fetub UTSW 16 22939367 missense probably benign 0.00
R1844:Fetub UTSW 16 22935669 missense possibly damaging 0.94
R1896:Fetub UTSW 16 22932295 missense probably damaging 1.00
R3716:Fetub UTSW 16 22935693 missense probably damaging 1.00
R3717:Fetub UTSW 16 22935693 missense probably damaging 1.00
R4274:Fetub UTSW 16 22935679 missense probably damaging 1.00
R4751:Fetub UTSW 16 22937895 missense probably benign 0.02
R4941:Fetub UTSW 16 22937874 missense probably benign 0.01
R5468:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5470:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5690:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5692:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5781:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6038:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6038:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6039:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6039:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6193:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6195:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6244:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6245:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6273:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6274:Fetub UTSW 16 22932331 missense probably damaging 1.00
R7134:Fetub UTSW 16 22929257 missense possibly damaging 0.54
R7698:Fetub UTSW 16 22939309 missense probably benign 0.31
R7969:Fetub UTSW 16 22929699 missense possibly damaging 0.89
R8788:Fetub UTSW 16 22939432 nonsense probably null
R8855:Fetub UTSW 16 22939571 missense possibly damaging 0.61
R8866:Fetub UTSW 16 22939571 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCCATAAGAGGGTAAGGCTATCTC -3'
(R):5'- AGCTTTACCTGGTTCATAGCC -3'

Sequencing Primer
(F):5'- TTTGGATGCTAGCACCTAGAAGC -3'
(R):5'- ACCTGGTTCATAGCCTTGGTGAC -3'
Posted On2020-10-20