Mutagenetix > Incidental Mutations

Incidental Mutation 'R8437:Usp25'

654067

Institutional Source

Beutler Lab

Gene Symbol

Usp25

Ensembl Gene

ENSMUSG00000022867

Gene Name

ubiquitin specific peptidase 25

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8437 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77013706-77116780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 77033912 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 19 (T19A)

Ref Sequence

ENSEMBL: ENSMUSP00000023580 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023580]

PDB Structure

Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023580
AA Change: T19A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: T19A

Domain	Start	End	E-Value	Type
PDB:1VDL\|A	1	67	2e-35	PDB
Blast:UBA	17	56	9e-16	BLAST
UIM	97	116	5.27e-3	SMART
Pfam:UIM	124	140	6.7e-3	PFAM
Pfam:UCH	168	655	9.3e-55	PFAM
Pfam:UCH_1	169	632	3.1e-14	PFAM
coiled coil region	685	714	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd2	T	C	7: 79,348,430	Y237H	probably damaging	Het
Adprh	T	C	16: 38,446,087	E231G	probably benign	Het
Anks6	T	C	4: 47,030,705	S631G	probably benign	Het
Bpifa5	T	A	2: 154,165,606	L156H	probably damaging	Het
Bsn	G	A	9: 108,111,452	A2367V	probably benign	Het
C8b	T	C	4: 104,786,843	Y236H	probably damaging	Het
Celf2	C	T	2: 6,547,145	G508S	probably damaging	Het
Clca1	T	C	3: 145,005,061	T794A	probably benign	Het
Col27a1	T	A	4: 63,319,464		probably benign	Het
Cyp2j12	C	T	4: 96,099,662	C497Y	probably damaging	Het
Dnmt3l	T	C	10: 78,052,768	I168T	possibly damaging	Het
Dtna	C	T	18: 23,590,341	Q201*	probably null	Het
Fetub	T	C	16: 22,934,235	S146P	possibly damaging	Het
Gak	T	G	5: 108,609,406	E242D	probably benign	Het
Gfpt2	T	A	11: 49,804,867		probably benign	Het
Ginm1	C	T	10: 7,770,366	C290Y	probably benign	Het
Hepacam	T	C	9: 37,384,710	S386P	probably damaging	Het
Hmcn2	C	A	2: 31,391,076	L1867I	probably benign	Het
Hnrnpa3	T	G	2: 75,662,675	S220A	unknown	Het
Hydin	A	G	8: 110,462,735	E1257G	probably damaging	Het
Ier3ip1	C	T	18: 76,930,178	A18V	probably damaging	Het
Ift140	T	A	17: 25,094,677	C1361S	probably damaging	Het
Il16	T	C	7: 83,652,143	Q955R	probably damaging	Het
Itpr3	T	G	17: 27,107,303	M1349R	probably damaging	Het
Kcnk4	C	T	19: 6,926,234	V316I	probably benign	Het
March6	A	G	15: 31,482,549	I501T	possibly damaging	Het
Msl2	T	A	9: 101,100,968	S180R	probably benign	Het
Muc16	C	T	9: 18,657,924	V1100I	unknown	Het
Nbas	T	C	12: 13,566,250	V2263A	possibly damaging	Het
Olfr1416	C	T	1: 92,480,465	S52N	probably benign	Het
Olfr853	C	T	9: 19,537,537	R131H	probably benign	Het
Pdilt	T	G	7: 119,514,886	I130L	possibly damaging	Het
Phldb3	A	G	7: 24,628,950	T640A	probably damaging	Het
Pole2	G	C	12: 69,204,187	Y467*	probably null	Het
Pxdn	C	T	12: 30,002,044	T740M	probably damaging	Het
Rabac1	T	C	7: 24,972,247	I83V	probably damaging	Het
Rrp7a	T	C	15: 83,117,572	Q245R	probably damaging	Het
Sae1	A	G	7: 16,370,354	V110A	probably damaging	Het
Sema3c	G	T	5: 17,662,938	V116F	probably damaging	Het
Serpina3i	A	G	12: 104,265,704	Y200C	probably damaging	Het
Slc25a45	C	T	19: 5,880,107	T35M	probably benign	Het
Speer4b	C	T	5: 27,498,820	R107Q	probably benign	Het
Sycp2	T	C	2: 178,364,858	T843A	probably damaging	Het
Tecta	T	A	9: 42,332,560	I2004F	probably damaging	Het
Tma16	T	C	8: 66,476,796	D182G	possibly damaging	Het
Topaz1	T	A	9: 122,781,362	Y1167*	probably null	Het
Uck1	C	A	2: 32,260,141		probably benign	Het
Vpreb2	G	A	16: 17,980,889	G80S	probably damaging	Het
Wdfy4	A	G	14: 33,076,375	C2025R		Het
Zyg11a	T	A	4: 108,217,906	H6L	probably damaging	Het

Other mutations in Usp25

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Usp25	APN	16	77062405	missense	probably damaging	1.00
IGL01359:Usp25	APN	16	77059253	missense	probably damaging	1.00
IGL01380:Usp25	APN	16	77093678	missense	probably benign	0.06
IGL01614:Usp25	APN	16	77077117	missense	probably damaging	1.00
IGL02065:Usp25	APN	16	77083782	missense	probably benign	0.06
IGL02271:Usp25	APN	16	77115447	missense	probably damaging	1.00
IGL03184:Usp25	APN	16	77081653	missense	probably damaging	1.00
IGL03046:Usp25	UTSW	16	77074866	missense	probably damaging	1.00
R0433:Usp25	UTSW	16	77109217	missense	probably benign	0.02
R0741:Usp25	UTSW	16	77071708	missense	possibly damaging	0.80
R0944:Usp25	UTSW	16	77081447	splice site	probably benign
R1324:Usp25	UTSW	16	77080387	missense	probably damaging	0.98
R1341:Usp25	UTSW	16	77115443	missense	probably benign
R1373:Usp25	UTSW	16	77062385	splice site	probably benign
R1641:Usp25	UTSW	16	77071671	missense	possibly damaging	0.89
R1777:Usp25	UTSW	16	77081554	missense	probably damaging	1.00
R1813:Usp25	UTSW	16	77114950	missense	probably benign	0.00
R1960:Usp25	UTSW	16	77076371	missense	probably damaging	1.00
R2256:Usp25	UTSW	16	77113794	missense	probably benign
R2271:Usp25	UTSW	16	77076429	missense	probably damaging	0.97
R4404:Usp25	UTSW	16	77115453	missense	probably damaging	1.00
R4408:Usp25	UTSW	16	77115453	missense	probably damaging	1.00
R4502:Usp25	UTSW	16	77115396	missense	probably damaging	1.00
R4604:Usp25	UTSW	16	77115415	missense	probably damaging	1.00
R4612:Usp25	UTSW	16	77033945	missense	possibly damaging	0.92
R4744:Usp25	UTSW	16	77114989	missense	probably damaging	1.00
R4867:Usp25	UTSW	16	77050467	missense	probably damaging	1.00
R4932:Usp25	UTSW	16	77033982	critical splice donor site	probably null
R5087:Usp25	UTSW	16	77077119	missense	probably benign	0.00
R5165:Usp25	UTSW	16	77076405	missense	possibly damaging	0.85
R5184:Usp25	UTSW	16	77109227	missense	probably benign	0.00
R5307:Usp25	UTSW	16	77093706	missense	probably benign
R5331:Usp25	UTSW	16	77050558	missense	probably damaging	1.00
R5355:Usp25	UTSW	16	77050454	missense	probably damaging	1.00
R5479:Usp25	UTSW	16	77107913	missense	possibly damaging	0.51
R5619:Usp25	UTSW	16	77033945	missense	probably benign	0.22
R5646:Usp25	UTSW	16	77050472	missense	probably benign	0.34
R5946:Usp25	UTSW	16	77115054	nonsense	probably null
R6013:Usp25	UTSW	16	77077021	missense	probably benign	0.00
R6418:Usp25	UTSW	16	77062442	missense	probably damaging	1.00
R6653:Usp25	UTSW	16	77059288	missense	probably benign	0.29
R6709:Usp25	UTSW	16	77083932	missense	probably benign
R6987:Usp25	UTSW	16	77077180	missense	probably damaging	1.00
R7418:Usp25	UTSW	16	77113842	nonsense	probably null
R7500:Usp25	UTSW	16	77077201	missense	probably damaging	1.00
R7886:Usp25	UTSW	16	77113771	missense	probably damaging	0.99
R7961:Usp25	UTSW	16	77059262	missense	probably damaging	1.00
R8005:Usp25	UTSW	16	77077068	missense	probably benign
R8046:Usp25	UTSW	16	77109175	missense	probably damaging	1.00
R8069:Usp25	UTSW	16	77069055	missense	possibly damaging	0.58
R8140:Usp25	UTSW	16	77071681	nonsense	probably null
R8167:Usp25	UTSW	16	77107931	missense	probably damaging	1.00
R8704:Usp25	UTSW	16	77059290	missense	probably benign	0.00
R8903:Usp25	UTSW	16	77081533	missense	probably damaging	1.00
X0065:Usp25	UTSW	16	77081556	missense	probably damaging	1.00
Z1176:Usp25	UTSW	16	77071791	missense	probably damaging	0.98
Z1176:Usp25	UTSW	16	77071792	missense	possibly damaging	0.93
Z1176:Usp25	UTSW	16	77081521	missense	probably damaging	1.00
Z1176:Usp25	UTSW	16	77083913	missense	probably benign
Z1176:Usp25	UTSW	16	77113830	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGTAGAGAAACGTCAGAGTTGC -3'
(R):5'- GCTCTCGCTTTATAAGAGACTGC -3'

Sequencing Primer
(F):5'- ACGTCAGAGTTGCGGCAG -3'
(R):5'- ATAAGAGACTGCTTTCCCGTC -3'

Posted On

2020-10-20