Incidental Mutation 'R8437:Slc25a45'
ID 654072
Institutional Source Beutler Lab
Gene Symbol Slc25a45
Ensembl Gene ENSMUSG00000024818
Gene Name solute carrier family 25, member 45
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R8437 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 5877808-5885766 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 5880107 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 35 (T35M)
Ref Sequence ENSEMBL: ENSMUSP00000025732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025728] [ENSMUST00000025732] [ENSMUST00000125114] [ENSMUST00000136833] [ENSMUST00000145200] [ENSMUST00000155227] [ENSMUST00000155697]
AlphaFold Q8CFJ7
Predicted Effect probably benign
Transcript: ENSMUST00000025728
SMART Domains Protein: ENSMUSP00000025728
Gene: ENSMUSG00000024816

DomainStartEndE-ValueType
B41 26 273 9.58e-4 SMART
low complexity region 383 398 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025732
AA Change: T35M

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025732
Gene: ENSMUSG00000024818
AA Change: T35M

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 1.2e-20 PFAM
Pfam:Mito_carr 95 195 6.9e-22 PFAM
Pfam:Mito_carr 197 288 7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125114
AA Change: T35M

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122076
Gene: ENSMUSG00000024818
AA Change: T35M

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 4.7e-22 PFAM
Pfam:Mito_carr 95 195 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136833
AA Change: T35M

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121602
Gene: ENSMUSG00000024818
AA Change: T35M

DomainStartEndE-ValueType
Pfam:Mito_carr 1 102 2.5e-20 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000114648
Gene: ENSMUSG00000024818
AA Change: T34M

DomainStartEndE-ValueType
Pfam:Mito_carr 1 70 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145200
SMART Domains Protein: ENSMUSP00000117220
Gene: ENSMUSG00000024818

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Mito_carr 37 137 5.1e-23 PFAM
Pfam:Mito_carr 139 195 4.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155227
SMART Domains Protein: ENSMUSP00000116453
Gene: ENSMUSG00000024816

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Pfam:FERM_M 136 202 9.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155697
AA Change: T35M

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121596
Gene: ENSMUSG00000024818
AA Change: T35M

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 8.9e-22 PFAM
Pfam:Mito_carr 95 195 6.8e-23 PFAM
Pfam:Mito_carr 197 288 2.4e-23 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A45 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Slc25a45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Slc25a45 APN 19 5884609 splice site probably null
IGL02620:Slc25a45 APN 19 5884526 missense probably damaging 1.00
IGL02622:Slc25a45 APN 19 5878697 splice site probably benign
R0055:Slc25a45 UTSW 19 5880467 missense probably damaging 1.00
R0055:Slc25a45 UTSW 19 5880467 missense probably damaging 1.00
R0630:Slc25a45 UTSW 19 5880528 missense probably damaging 1.00
R1464:Slc25a45 UTSW 19 5879900 splice site probably benign
R1764:Slc25a45 UTSW 19 5884930 missense probably damaging 1.00
R1902:Slc25a45 UTSW 19 5884522 missense probably damaging 1.00
R2372:Slc25a45 UTSW 19 5884552 missense probably benign 0.00
R3547:Slc25a45 UTSW 19 5884546 missense probably damaging 1.00
R3889:Slc25a45 UTSW 19 5880633 splice site probably benign
R4173:Slc25a45 UTSW 19 5880583 nonsense probably null
R4222:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4223:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4225:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4598:Slc25a45 UTSW 19 5884436 missense probably damaging 1.00
R4998:Slc25a45 UTSW 19 5884917 missense probably damaging 1.00
R5063:Slc25a45 UTSW 19 5884462 missense possibly damaging 0.89
R5711:Slc25a45 UTSW 19 5884423 missense probably benign
R6693:Slc25a45 UTSW 19 5880134 missense possibly damaging 0.63
R7486:Slc25a45 UTSW 19 5884969 missense probably damaging 0.96
R9415:Slc25a45 UTSW 19 5884939 missense probably damaging 1.00
Z1177:Slc25a45 UTSW 19 5880179 missense unknown
Z1177:Slc25a45 UTSW 19 5884432 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAGTGTAGCAAAGGCACC -3'
(R):5'- GTCACCACTTTTGAGGCACTAG -3'

Sequencing Primer
(F):5'- ATAGATGGTCTGGCTGGAACC -3'
(R):5'- CACTTTTGAGGCACTAGAGGACTC -3'
Posted On 2020-10-20