Incidental Mutation 'R8437:Kcnk4'
ID654073
Institutional Source Beutler Lab
Gene Symbol Kcnk4
Ensembl Gene ENSMUSG00000024957
Gene Namepotassium channel, subfamily K, member 4
SynonymsTRAAKt
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8437 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6925710-6934515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6926234 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 316 (V316I)
Ref Sequence ENSEMBL: ENSMUSP00000025908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025906] [ENSMUST00000025908] [ENSMUST00000057716] [ENSMUST00000173635]
Predicted Effect probably benign
Transcript: ENSMUST00000025906
SMART Domains Protein: ENSMUSP00000025906
Gene: ENSMUSG00000024955

DomainStartEndE-ValueType
internal_repeat_1 5 21 6.74e-5 PROSPERO
low complexity region 52 67 N/A INTRINSIC
ZnF_C4 76 147 2.16e-40 SMART
low complexity region 169 187 N/A INTRINSIC
internal_repeat_1 202 218 6.74e-5 PROSPERO
HOLI 229 391 9.21e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025908
AA Change: V316I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000025908
Gene: ENSMUSG00000024957
AA Change: V316I

DomainStartEndE-ValueType
Pfam:Ion_trans 2 147 8.1e-9 PFAM
Pfam:Ion_trans_2 64 145 1.7e-21 PFAM
Pfam:Ion_trans_2 174 260 5.3e-22 PFAM
low complexity region 303 319 N/A INTRINSIC
low complexity region 367 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057716
SMART Domains Protein: ENSMUSP00000056681
Gene: ENSMUSG00000050623

DomainStartEndE-ValueType
low complexity region 104 118 N/A INTRINSIC
low complexity region 137 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173635
SMART Domains Protein: ENSMUSP00000134587
Gene: ENSMUSG00000024955

DomainStartEndE-ValueType
PDB:1LO1|A 1 21 6e-7 PDB
low complexity region 26 44 N/A INTRINSIC
Pfam:Hormone_recep 65 158 4.7e-18 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TWIK-related arachidonic acid-stimulated two pore potassium channel subfamily. The encoded protein homodimerizes and functions as an outwardly rectifying channel. This channel is regulated by polyunsaturated fatty acids, temperature and mechanical deformation of the lipid membrane. This protein is expressed primarily in neural tissues and may be involved in regulating the noxious input threshold in dorsal root ganglia neurons. Alternate splicing results in multiple transcript variants. Naturally occurring read-through transcripts also exist between this gene and the downstream testis expressed 40 (TEX40) gene, as represented in GeneID: 106780802. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit normal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Gfpt2 T A 11: 49,804,867 probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Kcnk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Kcnk4 APN 19 6927177 missense probably damaging 1.00
IGL02047:Kcnk4 APN 19 6926258 missense probably benign 0.00
IGL02726:Kcnk4 APN 19 6927089 critical splice donor site probably null
R0149:Kcnk4 UTSW 19 6926194 missense probably benign 0.08
R0617:Kcnk4 UTSW 19 6928160 unclassified probably benign
R1392:Kcnk4 UTSW 19 6927663 missense possibly damaging 0.80
R1392:Kcnk4 UTSW 19 6927663 missense possibly damaging 0.80
R3017:Kcnk4 UTSW 19 6927794 missense probably damaging 0.96
R4439:Kcnk4 UTSW 19 6932761 missense probably benign 0.01
R4895:Kcnk4 UTSW 19 6928416 splice site probably null
R5208:Kcnk4 UTSW 19 6927701 missense possibly damaging 0.79
R5409:Kcnk4 UTSW 19 6926210 missense probably benign 0.00
R5743:Kcnk4 UTSW 19 6928355 missense possibly damaging 0.69
R6233:Kcnk4 UTSW 19 6928329 missense probably benign 0.29
R6466:Kcnk4 UTSW 19 6928297 missense probably damaging 1.00
R7358:Kcnk4 UTSW 19 6926110 missense probably damaging 1.00
R8040:Kcnk4 UTSW 19 6927627 missense probably damaging 1.00
R8356:Kcnk4 UTSW 19 6926300 missense probably benign
R8444:Kcnk4 UTSW 19 6926140 missense probably damaging 1.00
R8805:Kcnk4 UTSW 19 6928011 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCTGAGCATCAGCAAGAG -3'
(R):5'- GGTAAAAGGGCAGCTTTCGG -3'

Sequencing Primer
(F):5'- ATCCGGGTCCAGAGATCC -3'
(R):5'- TCGGAGCTGCAATGGGTC -3'
Posted On2020-10-20