Incidental Mutation 'R8438:Morn5'
ID654077
Institutional Source Beutler Lab
Gene Symbol Morn5
Ensembl Gene ENSMUSG00000026894
Gene NameMORN repeat containing 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R8438 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location36049458-36079718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36055064 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 100 (K100R)
Ref Sequence ENSEMBL: ENSMUSP00000028256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028256]
Predicted Effect probably benign
Transcript: ENSMUST00000028256
AA Change: K100R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028256
Gene: ENSMUSG00000026894
AA Change: K100R

DomainStartEndE-ValueType
MORN 6 27 1.24e1 SMART
MORN 29 50 3.61e-2 SMART
Pfam:MORN 54 75 2e-4 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,290,666 probably null Het
5730480H06Rik A T 5: 48,377,083 H95L probably damaging Het
Abca8a A G 11: 110,075,578 Y410H probably damaging Het
Abcb4 G A 5: 8,946,120 probably null Het
Adam8 C T 7: 139,985,336 probably null Het
Aldh1l1 C T 6: 90,559,446 P111L probably damaging Het
Baz2b G T 2: 59,917,484 Y1278* probably null Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp9 C A 4: 141,813,623 T434N probably benign Het
Ccdc129 C T 6: 55,897,893 S276L probably damaging Het
Cd19 C A 7: 126,414,343 M91I possibly damaging Het
Celsr2 G A 3: 108,393,823 T2718M probably damaging Het
Clptm1 G T 7: 19,645,851 D153E probably benign Het
Col1a2 G A 6: 4,515,517 G127S unknown Het
Col1a2 G T 6: 4,515,518 G127V unknown Het
Crybg3 A G 16: 59,565,292 S190P probably benign Het
Ddrgk1 G A 2: 130,663,382 probably benign Het
Dennd1a T C 2: 37,856,138 H402R probably benign Het
Dgat2 T C 7: 99,157,000 Y330C probably damaging Het
Dnah7b G A 1: 46,188,679 C1354Y probably damaging Het
Ecd T A 14: 20,338,465 I119L possibly damaging Het
Entpd1 A G 19: 40,736,780 K437E possibly damaging Het
Fcgbp C T 7: 28,089,806 A599V probably benign Het
Gtf3c1 G T 7: 125,642,529 S1999* probably null Het
Hesx1 C T 14: 27,001,503 R97C probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hoxb3 A G 11: 96,345,783 N229S probably benign Het
Itpk1 G A 12: 102,606,159 probably benign Het
Masp1 T C 16: 23,470,403 D549G probably benign Het
Mef2c A G 13: 83,656,217 E312G probably damaging Het
Mphosph9 A T 5: 124,292,392 D610E probably benign Het
Obox6 G C 7: 15,833,928 A198G probably damaging Het
Olfr1248 C T 2: 89,617,710 V161M possibly damaging Het
Olfr1253 A T 2: 89,752,717 M37K probably damaging Het
Olfr224 A T 11: 58,566,839 S169T possibly damaging Het
Olfr524 C A 7: 140,202,257 C171F probably damaging Het
Pcdhgb2 A G 18: 37,692,179 N741S probably benign Het
Plekhh2 A G 17: 84,569,951 N575D probably benign Het
Plxna4 C A 6: 32,202,180 G967W probably damaging Het
Ppp3cb C T 14: 20,515,590 M373I probably damaging Het
Sec14l2 C A 11: 4,109,202 E156* probably null Het
Srrt A T 5: 137,303,000 Y55N unknown Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Thada G A 17: 84,435,629 T789I probably damaging Het
Top3b G T 16: 16,891,500 S684I probably benign Het
Trpc4 A G 3: 54,222,253 I147V possibly damaging Het
Tubgcp5 T A 7: 55,804,615 H219Q possibly damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Vmn1r31 T A 6: 58,472,661 D73V Het
Wasf3 A T 5: 146,453,427 Q127L probably benign Het
Xpo6 T C 7: 126,160,882 T182A possibly damaging Het
Xpo7 C A 14: 70,703,232 R139S probably benign Het
Zfp687 A T 3: 95,008,122 S1058T probably benign Het
Zfp786 T C 6: 47,820,000 E668G probably damaging Het
Zfp831 A T 2: 174,645,003 R490S possibly damaging Het
Other mutations in Morn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Morn5 APN 2 36057076 missense probably damaging 1.00
IGL02190:Morn5 APN 2 36079515 missense probably benign 0.03
IGL02441:Morn5 APN 2 36055026 nonsense probably null
IGL02899:Morn5 APN 2 36055037 missense probably damaging 1.00
R0306:Morn5 UTSW 2 36054974 missense probably damaging 1.00
R1449:Morn5 UTSW 2 36057080 nonsense probably null
R1803:Morn5 UTSW 2 36053077 missense probably benign 0.03
R1819:Morn5 UTSW 2 36052975 missense probably damaging 1.00
R2012:Morn5 UTSW 2 36052938 missense probably benign 0.03
R3932:Morn5 UTSW 2 36053023 missense probably damaging 0.99
R7078:Morn5 UTSW 2 36054978 missense probably benign
R7681:Morn5 UTSW 2 36057144 missense possibly damaging 0.95
R7938:Morn5 UTSW 2 36057070 missense probably benign 0.03
R8805:Morn5 UTSW 2 36079521 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TTCCTGTTGGCTGCGAGAAG -3'
(R):5'- AGAGATGGAGTCCCTTGGTCTC -3'

Sequencing Primer
(F):5'- GAGAAGCCAACTATTCCCTTGG -3'
(R):5'- CTCATTGTTCTGATCAGCTAGTG -3'
Posted On2020-10-20