Incidental Mutation 'R8438:Baz2b'
ID 654079
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Name bromodomain adjacent to zinc finger domain, 2B
Synonyms D2Ertd794e, 5830435C13Rik
MMRRC Submission 067778-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R8438 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 59729707-60040183 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 59747828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1278 (Y1278*)
Ref Sequence ENSEMBL: ENSMUSP00000088443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
AlphaFold A2AUY4
Predicted Effect probably null
Transcript: ENSMUST00000090925
AA Change: Y1278*
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: Y1278*

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112550
AA Change: Y1278*
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: Y1278*

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130637
SMART Domains Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987

DomainStartEndE-ValueType
Pfam:WHIM3 2 37 1.8e-13 PFAM
low complexity region 162 173 N/A INTRINSIC
PHD 214 253 2.05e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,201,962 (GRCm39) probably null Het
5730480H06Rik A T 5: 48,534,425 (GRCm39) H95L probably damaging Het
Abca8a A G 11: 109,966,404 (GRCm39) Y410H probably damaging Het
Abcb4 G A 5: 8,996,120 (GRCm39) probably null Het
Adam8 C T 7: 139,565,249 (GRCm39) probably null Het
Aldh1l1 C T 6: 90,536,428 (GRCm39) P111L probably damaging Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Casp9 C A 4: 141,540,934 (GRCm39) T434N probably benign Het
Cd19 C A 7: 126,013,515 (GRCm39) M91I possibly damaging Het
Celsr2 G A 3: 108,301,139 (GRCm39) T2718M probably damaging Het
Clptm1 G T 7: 19,379,776 (GRCm39) D153E probably benign Het
Col1a2 G A 6: 4,515,517 (GRCm39) G127S unknown Het
Col1a2 G T 6: 4,515,518 (GRCm39) G127V unknown Het
Crybg3 A G 16: 59,385,655 (GRCm39) S190P probably benign Het
Ddrgk1 G A 2: 130,505,302 (GRCm39) probably benign Het
Dennd1a T C 2: 37,746,150 (GRCm39) H402R probably benign Het
Dgat2 T C 7: 98,806,207 (GRCm39) Y330C probably damaging Het
Dnah7b G A 1: 46,227,839 (GRCm39) C1354Y probably damaging Het
Ecd T A 14: 20,388,533 (GRCm39) I119L possibly damaging Het
Entpd1 A G 19: 40,725,224 (GRCm39) K437E possibly damaging Het
Fcgbp C T 7: 27,789,231 (GRCm39) A599V probably benign Het
Gtf3c1 G T 7: 125,241,701 (GRCm39) S1999* probably null Het
Hesx1 C T 14: 26,723,460 (GRCm39) R97C probably benign Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Hoxb3 A G 11: 96,236,609 (GRCm39) N229S probably benign Het
Itpk1 G A 12: 102,572,418 (GRCm39) probably benign Het
Itprid1 C T 6: 55,874,878 (GRCm39) S276L probably damaging Het
Masp1 T C 16: 23,289,153 (GRCm39) D549G probably benign Het
Mef2c A G 13: 83,804,336 (GRCm39) E312G probably damaging Het
Morn5 A G 2: 35,945,076 (GRCm39) K100R probably benign Het
Mphosph9 A T 5: 124,430,455 (GRCm39) D610E probably benign Het
Obox6 G C 7: 15,567,853 (GRCm39) A198G probably damaging Het
Or2t43 A T 11: 58,457,665 (GRCm39) S169T possibly damaging Het
Or4a75 C T 2: 89,448,054 (GRCm39) V161M possibly damaging Het
Or4a80 A T 2: 89,583,061 (GRCm39) M37K probably damaging Het
Or6b13 C A 7: 139,782,170 (GRCm39) C171F probably damaging Het
Pcdhgb2 A G 18: 37,825,232 (GRCm39) N741S probably benign Het
Plekhh2 A G 17: 84,877,379 (GRCm39) N575D probably benign Het
Plxna4 C A 6: 32,179,115 (GRCm39) G967W probably damaging Het
Ppp3cb C T 14: 20,565,658 (GRCm39) M373I probably damaging Het
Sec14l2 C A 11: 4,059,202 (GRCm39) E156* probably null Het
Srrt A T 5: 137,301,262 (GRCm39) Y55N unknown Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,354,015 (GRCm39) probably benign Het
Thada G A 17: 84,743,057 (GRCm39) T789I probably damaging Het
Top3b G T 16: 16,709,364 (GRCm39) S684I probably benign Het
Trpc4 A G 3: 54,129,674 (GRCm39) I147V possibly damaging Het
Tubgcp5 T A 7: 55,454,363 (GRCm39) H219Q possibly damaging Het
Uck1 C A 2: 32,150,153 (GRCm39) probably benign Het
Vmn1r31 T A 6: 58,449,646 (GRCm39) D73V Het
Wasf3 A T 5: 146,390,237 (GRCm39) Q127L probably benign Het
Xpo6 T C 7: 125,760,054 (GRCm39) T182A possibly damaging Het
Xpo7 C A 14: 70,940,672 (GRCm39) R139S probably benign Het
Zfp687 A T 3: 94,915,433 (GRCm39) S1058T probably benign Het
Zfp786 T C 6: 47,796,934 (GRCm39) E668G probably damaging Het
Zfp831 A T 2: 174,486,796 (GRCm39) R490S possibly damaging Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59,743,139 (GRCm39) missense probably benign 0.02
IGL00476:Baz2b APN 2 59,744,083 (GRCm39) missense probably benign 0.06
IGL00489:Baz2b APN 2 59,788,019 (GRCm39) nonsense probably null
IGL00514:Baz2b APN 2 59,792,821 (GRCm39) missense probably benign 0.11
IGL00678:Baz2b APN 2 59,836,527 (GRCm39) missense unknown
IGL01348:Baz2b APN 2 59,764,031 (GRCm39) missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59,799,233 (GRCm39) missense probably benign 0.18
IGL01924:Baz2b APN 2 59,765,615 (GRCm39) missense probably damaging 1.00
IGL02125:Baz2b APN 2 59,798,984 (GRCm39) missense probably benign 0.12
IGL02314:Baz2b APN 2 59,792,571 (GRCm39) missense probably benign
IGL02370:Baz2b APN 2 59,753,933 (GRCm39) missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59,790,407 (GRCm39) missense probably benign 0.40
IGL02499:Baz2b APN 2 59,731,840 (GRCm39) missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59,747,713 (GRCm39) missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59,778,604 (GRCm39) missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59,747,849 (GRCm39) unclassified probably benign
IGL02716:Baz2b APN 2 59,792,868 (GRCm39) missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59,807,718 (GRCm39) missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59,799,002 (GRCm39) missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59,807,872 (GRCm39) missense probably benign 0.00
IGL02886:Baz2b APN 2 59,788,087 (GRCm39) splice site probably null
IGL02892:Baz2b APN 2 59,731,080 (GRCm39) missense probably damaging 1.00
IGL03132:Baz2b APN 2 59,738,097 (GRCm39) splice site probably benign
IGL03183:Baz2b APN 2 59,733,640 (GRCm39) missense probably benign 0.10
IGL03197:Baz2b APN 2 59,731,898 (GRCm39) missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0054:Baz2b UTSW 2 59,762,510 (GRCm39) missense probably damaging 1.00
R0122:Baz2b UTSW 2 59,743,963 (GRCm39) splice site probably null
R0136:Baz2b UTSW 2 59,732,298 (GRCm39) missense probably benign 0.22
R0144:Baz2b UTSW 2 59,737,839 (GRCm39) missense probably damaging 0.98
R0403:Baz2b UTSW 2 59,799,721 (GRCm39) missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59,732,340 (GRCm39) unclassified probably benign
R0528:Baz2b UTSW 2 59,767,083 (GRCm39) missense probably damaging 1.00
R1025:Baz2b UTSW 2 59,792,826 (GRCm39) missense probably benign 0.06
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59,808,890 (GRCm39) missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59,752,553 (GRCm39) missense probably damaging 1.00
R1511:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R1514:Baz2b UTSW 2 59,792,670 (GRCm39) missense probably benign 0.13
R1519:Baz2b UTSW 2 59,778,598 (GRCm39) missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59,798,981 (GRCm39) missense possibly damaging 0.47
R1630:Baz2b UTSW 2 59,836,474 (GRCm39) missense unknown
R1641:Baz2b UTSW 2 59,743,234 (GRCm39) missense probably damaging 0.99
R1674:Baz2b UTSW 2 59,743,336 (GRCm39) missense possibly damaging 0.53
R1778:Baz2b UTSW 2 59,836,480 (GRCm39) missense unknown
R1826:Baz2b UTSW 2 59,799,077 (GRCm39) missense probably benign 0.12
R1835:Baz2b UTSW 2 59,732,163 (GRCm39) missense probably benign 0.02
R1954:Baz2b UTSW 2 59,799,087 (GRCm39) missense probably benign 0.12
R1981:Baz2b UTSW 2 59,754,024 (GRCm39) missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59,743,067 (GRCm39) unclassified probably benign
R2567:Baz2b UTSW 2 59,744,255 (GRCm39) missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59,743,348 (GRCm39) missense probably benign 0.27
R2848:Baz2b UTSW 2 59,755,010 (GRCm39) missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59,799,240 (GRCm39) missense probably benign 0.12
R3935:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59,743,105 (GRCm39) missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59,742,917 (GRCm39) splice site probably null
R4182:Baz2b UTSW 2 59,928,801 (GRCm39) intron probably benign
R4255:Baz2b UTSW 2 59,750,916 (GRCm39) unclassified probably benign
R4359:Baz2b UTSW 2 59,731,957 (GRCm39) missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59,799,599 (GRCm39) missense probably benign 0.06
R4743:Baz2b UTSW 2 59,744,255 (GRCm39) missense probably benign 0.01
R4772:Baz2b UTSW 2 59,788,795 (GRCm39) missense probably damaging 0.96
R4858:Baz2b UTSW 2 59,738,087 (GRCm39) missense probably benign
R4868:Baz2b UTSW 2 59,755,226 (GRCm39) missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59,773,103 (GRCm39) splice site probably null
R4889:Baz2b UTSW 2 59,767,070 (GRCm39) missense probably damaging 1.00
R4890:Baz2b UTSW 2 59,756,383 (GRCm39) missense probably damaging 0.99
R4914:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59,744,387 (GRCm39) missense possibly damaging 0.70
R5027:Baz2b UTSW 2 59,928,988 (GRCm39) intron probably benign
R5031:Baz2b UTSW 2 59,743,151 (GRCm39) missense probably benign 0.00
R5082:Baz2b UTSW 2 59,731,835 (GRCm39) nonsense probably null
R5133:Baz2b UTSW 2 59,792,368 (GRCm39) missense probably benign 0.12
R5276:Baz2b UTSW 2 59,792,958 (GRCm39) missense probably benign 0.40
R5279:Baz2b UTSW 2 59,762,496 (GRCm39) missense probably damaging 1.00
R5294:Baz2b UTSW 2 59,808,946 (GRCm39) missense probably benign 0.11
R5447:Baz2b UTSW 2 59,744,332 (GRCm39) missense probably damaging 0.99
R5903:Baz2b UTSW 2 59,790,233 (GRCm39) missense probably damaging 0.99
R5910:Baz2b UTSW 2 59,807,770 (GRCm39) missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59,742,871 (GRCm39) missense probably damaging 0.99
R6195:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59,809,019 (GRCm39) missense probably benign 0.00
R6208:Baz2b UTSW 2 59,755,150 (GRCm39) missense probably damaging 1.00
R6233:Baz2b UTSW 2 59,737,855 (GRCm39) missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59,778,567 (GRCm39) missense probably damaging 1.00
R6324:Baz2b UTSW 2 59,737,292 (GRCm39) missense probably damaging 1.00
R6490:Baz2b UTSW 2 59,732,073 (GRCm39) missense probably damaging 1.00
R6578:Baz2b UTSW 2 59,799,623 (GRCm39) missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59,755,234 (GRCm39) missense probably damaging 1.00
R6760:Baz2b UTSW 2 59,792,776 (GRCm39) missense probably benign 0.40
R6836:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R6859:Baz2b UTSW 2 59,731,874 (GRCm39) missense probably benign 0.01
R6880:Baz2b UTSW 2 59,743,283 (GRCm39) missense probably damaging 0.99
R6916:Baz2b UTSW 2 59,799,120 (GRCm39) missense probably benign
R6978:Baz2b UTSW 2 59,738,059 (GRCm39) missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59,764,014 (GRCm39) critical splice donor site probably null
R7112:Baz2b UTSW 2 59,792,528 (GRCm39) missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59,742,841 (GRCm39) missense
R7198:Baz2b UTSW 2 59,792,550 (GRCm39) missense probably benign 0.00
R7270:Baz2b UTSW 2 59,792,836 (GRCm39) missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59,750,781 (GRCm39) missense probably benign 0.17
R7464:Baz2b UTSW 2 59,807,792 (GRCm39) missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59,792,817 (GRCm39) missense probably benign 0.40
R7703:Baz2b UTSW 2 59,747,769 (GRCm39) missense probably damaging 1.00
R7850:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7851:Baz2b UTSW 2 59,767,060 (GRCm39) missense probably damaging 0.98
R7988:Baz2b UTSW 2 59,792,485 (GRCm39) missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59,731,112 (GRCm39) missense probably damaging 1.00
R8084:Baz2b UTSW 2 59,792,580 (GRCm39) missense probably benign
R8343:Baz2b UTSW 2 59,731,858 (GRCm39) missense probably damaging 1.00
R8348:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8448:Baz2b UTSW 2 59,742,137 (GRCm39) missense
R8511:Baz2b UTSW 2 59,732,158 (GRCm39) missense probably benign
R8893:Baz2b UTSW 2 59,755,149 (GRCm39) missense probably damaging 0.96
R8947:Baz2b UTSW 2 59,778,583 (GRCm39) missense probably benign 0.06
R8998:Baz2b UTSW 2 59,799,608 (GRCm39) missense probably benign 0.02
R9241:Baz2b UTSW 2 59,743,993 (GRCm39) missense probably benign 0.01
R9245:Baz2b UTSW 2 59,743,331 (GRCm39) missense probably benign
R9577:Baz2b UTSW 2 59,809,031 (GRCm39) missense probably benign 0.06
R9581:Baz2b UTSW 2 59,799,300 (GRCm39) missense probably benign
R9601:Baz2b UTSW 2 59,731,847 (GRCm39) missense possibly damaging 0.66
R9613:Baz2b UTSW 2 59,731,824 (GRCm39) missense probably benign 0.09
R9639:Baz2b UTSW 2 59,731,828 (GRCm39) missense probably benign 0.01
X0011:Baz2b UTSW 2 59,807,705 (GRCm39) missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59,731,019 (GRCm39) missense probably damaging 1.00
X0064:Baz2b UTSW 2 59,799,626 (GRCm39) missense probably benign
Z1088:Baz2b UTSW 2 59,790,359 (GRCm39) missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59,807,864 (GRCm39) missense probably benign 0.01
Z1188:Baz2b UTSW 2 59,807,749 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTAACAAGCTTTTGAAACCCC -3'
(R):5'- GGCAGTACACTGGAATTGGC -3'

Sequencing Primer
(F):5'- CCCACAATATCCCAGTTAGGAG -3'
(R):5'- CAGTACACTGGAATTGGCCTATTTGC -3'
Posted On 2020-10-20