Incidental Mutation 'R8438:Mphosph9'
ID 654091
Institutional Source Beutler Lab
Gene Symbol Mphosph9
Ensembl Gene ENSMUSG00000038126
Gene Name M-phase phosphoprotein 9
Synonyms MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8438 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 124250959-124327972 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 124292392 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 610 (D610E)
Ref Sequence ENSEMBL: ENSMUSP00000138982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000130502] [ENSMUST00000147737] [ENSMUST00000184951]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031344
AA Change: D580E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: D580E

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
coiled coil region 574 736 N/A INTRINSIC
low complexity region 879 898 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
coiled coil region 1040 1105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130502
SMART Domains Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126

DomainStartEndE-ValueType
low complexity region 47 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147737
Predicted Effect probably benign
Transcript: ENSMUST00000184951
AA Change: D610E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: D610E

DomainStartEndE-ValueType
coiled coil region 102 130 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
low complexity region 444 458 N/A INTRINSIC
coiled coil region 604 766 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
low complexity region 987 1001 N/A INTRINSIC
coiled coil region 1070 1135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,290,666 probably null Het
5730480H06Rik A T 5: 48,377,083 H95L probably damaging Het
Abca8a A G 11: 110,075,578 Y410H probably damaging Het
Abcb4 G A 5: 8,946,120 probably null Het
Adam8 C T 7: 139,985,336 probably null Het
Aldh1l1 C T 6: 90,559,446 P111L probably damaging Het
Baz2b G T 2: 59,917,484 Y1278* probably null Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp9 C A 4: 141,813,623 T434N probably benign Het
Ccdc129 C T 6: 55,897,893 S276L probably damaging Het
Cd19 C A 7: 126,414,343 M91I possibly damaging Het
Celsr2 G A 3: 108,393,823 T2718M probably damaging Het
Clptm1 G T 7: 19,645,851 D153E probably benign Het
Col1a2 G A 6: 4,515,517 G127S unknown Het
Col1a2 G T 6: 4,515,518 G127V unknown Het
Crybg3 A G 16: 59,565,292 S190P probably benign Het
Ddrgk1 G A 2: 130,663,382 probably benign Het
Dennd1a T C 2: 37,856,138 H402R probably benign Het
Dgat2 T C 7: 99,157,000 Y330C probably damaging Het
Dnah7b G A 1: 46,188,679 C1354Y probably damaging Het
Ecd T A 14: 20,338,465 I119L possibly damaging Het
Entpd1 A G 19: 40,736,780 K437E possibly damaging Het
Fcgbp C T 7: 28,089,806 A599V probably benign Het
Gtf3c1 G T 7: 125,642,529 S1999* probably null Het
Hesx1 C T 14: 27,001,503 R97C probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hoxb3 A G 11: 96,345,783 N229S probably benign Het
Itpk1 G A 12: 102,606,159 probably benign Het
Masp1 T C 16: 23,470,403 D549G probably benign Het
Mef2c A G 13: 83,656,217 E312G probably damaging Het
Morn5 A G 2: 36,055,064 K100R probably benign Het
Obox6 G C 7: 15,833,928 A198G probably damaging Het
Olfr1248 C T 2: 89,617,710 V161M possibly damaging Het
Olfr1253 A T 2: 89,752,717 M37K probably damaging Het
Olfr224 A T 11: 58,566,839 S169T possibly damaging Het
Olfr524 C A 7: 140,202,257 C171F probably damaging Het
Pcdhgb2 A G 18: 37,692,179 N741S probably benign Het
Plekhh2 A G 17: 84,569,951 N575D probably benign Het
Plxna4 C A 6: 32,202,180 G967W probably damaging Het
Ppp3cb C T 14: 20,515,590 M373I probably damaging Het
Sec14l2 C A 11: 4,109,202 E156* probably null Het
Srrt A T 5: 137,303,000 Y55N unknown Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Thada G A 17: 84,435,629 T789I probably damaging Het
Top3b G T 16: 16,891,500 S684I probably benign Het
Trpc4 A G 3: 54,222,253 I147V possibly damaging Het
Tubgcp5 T A 7: 55,804,615 H219Q possibly damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Vmn1r31 T A 6: 58,472,661 D73V Het
Wasf3 A T 5: 146,453,427 Q127L probably benign Het
Xpo6 T C 7: 126,160,882 T182A possibly damaging Het
Xpo7 C A 14: 70,703,232 R139S probably benign Het
Zfp687 A T 3: 95,008,122 S1058T probably benign Het
Zfp786 T C 6: 47,820,000 E668G probably damaging Het
Zfp831 A T 2: 174,645,003 R490S possibly damaging Het
Other mutations in Mphosph9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mphosph9 APN 5 124262021 missense probably damaging 1.00
IGL01527:Mphosph9 APN 5 124283624 splice site probably benign
IGL01784:Mphosph9 APN 5 124265310 splice site probably benign
IGL01958:Mphosph9 APN 5 124324990 utr 5 prime probably benign
IGL02020:Mphosph9 APN 5 124258950 missense probably damaging 0.99
IGL02190:Mphosph9 APN 5 124265425 missense possibly damaging 0.92
IGL02261:Mphosph9 APN 5 124260087 missense probably damaging 1.00
IGL02569:Mphosph9 APN 5 124297571 nonsense probably null
IGL02640:Mphosph9 APN 5 124315500 missense possibly damaging 0.66
IGL02702:Mphosph9 APN 5 124259989 missense probably damaging 1.00
IGL02793:Mphosph9 APN 5 124283737 critical splice acceptor site probably null
IGL02813:Mphosph9 APN 5 124315628 missense probably benign 0.37
IGL02875:Mphosph9 APN 5 124283737 critical splice acceptor site probably null
IGL03149:Mphosph9 APN 5 124263011 missense probably damaging 1.00
PIT4445001:Mphosph9 UTSW 5 124298790 missense possibly damaging 0.82
R0304:Mphosph9 UTSW 5 124298829 missense probably benign 0.01
R0437:Mphosph9 UTSW 5 124315568 missense probably benign 0.27
R0483:Mphosph9 UTSW 5 124306970 nonsense probably null
R0811:Mphosph9 UTSW 5 124298759 missense probably damaging 1.00
R0812:Mphosph9 UTSW 5 124298759 missense probably damaging 1.00
R0942:Mphosph9 UTSW 5 124262037 nonsense probably null
R1175:Mphosph9 UTSW 5 124315676 missense possibly damaging 0.94
R1372:Mphosph9 UTSW 5 124283745 splice site probably null
R1442:Mphosph9 UTSW 5 124265398 missense possibly damaging 0.62
R1533:Mphosph9 UTSW 5 124267141 missense probably damaging 1.00
R1959:Mphosph9 UTSW 5 124315701 missense possibly damaging 0.92
R2036:Mphosph9 UTSW 5 124304211 missense probably damaging 0.97
R2256:Mphosph9 UTSW 5 124283659 missense probably benign 0.00
R2919:Mphosph9 UTSW 5 124261006 missense probably benign 0.22
R2920:Mphosph9 UTSW 5 124261006 missense probably benign 0.22
R4064:Mphosph9 UTSW 5 124290917 missense probably damaging 1.00
R4272:Mphosph9 UTSW 5 124304203 missense probably damaging 0.96
R4430:Mphosph9 UTSW 5 124265446 missense possibly damaging 0.83
R4883:Mphosph9 UTSW 5 124299045 missense probably damaging 1.00
R4992:Mphosph9 UTSW 5 124304190 missense probably damaging 1.00
R5815:Mphosph9 UTSW 5 124315418 missense probably damaging 1.00
R5993:Mphosph9 UTSW 5 124316098 missense probably benign 0.40
R6102:Mphosph9 UTSW 5 124297709 missense possibly damaging 0.86
R6295:Mphosph9 UTSW 5 124320915 missense possibly damaging 0.46
R6320:Mphosph9 UTSW 5 124324961 missense probably damaging 0.99
R6628:Mphosph9 UTSW 5 124298762 missense probably damaging 0.98
R6692:Mphosph9 UTSW 5 124260116 missense probably damaging 1.00
R6705:Mphosph9 UTSW 5 124290964 missense possibly damaging 0.83
R6747:Mphosph9 UTSW 5 124297699 missense possibly damaging 0.93
R6787:Mphosph9 UTSW 5 124261027 missense probably damaging 0.99
R6850:Mphosph9 UTSW 5 124260956 missense probably damaging 1.00
R6956:Mphosph9 UTSW 5 124297558 missense probably damaging 1.00
R7075:Mphosph9 UTSW 5 124320859 missense probably damaging 0.99
R7604:Mphosph9 UTSW 5 124316117 missense probably benign 0.01
R7789:Mphosph9 UTSW 5 124315587 missense probably damaging 1.00
R7808:Mphosph9 UTSW 5 124260946 missense probably damaging 0.99
R7823:Mphosph9 UTSW 5 124304256 missense probably damaging 0.99
R7891:Mphosph9 UTSW 5 124290904 missense probably damaging 1.00
R8210:Mphosph9 UTSW 5 124267111 missense probably damaging 1.00
R8256:Mphosph9 UTSW 5 124255106 missense probably damaging 1.00
R8385:Mphosph9 UTSW 5 124312722 missense probably benign 0.19
R8692:Mphosph9 UTSW 5 124312812 missense probably damaging 0.99
R8790:Mphosph9 UTSW 5 124315673 missense probably damaging 1.00
R8818:Mphosph9 UTSW 5 124324964 nonsense probably null
R8847:Mphosph9 UTSW 5 124316146 missense possibly damaging 0.91
R9018:Mphosph9 UTSW 5 124298650 missense probably benign 0.12
R9208:Mphosph9 UTSW 5 124312791 missense probably damaging 0.97
R9221:Mphosph9 UTSW 5 124265364 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGCACTCCTGGTTACACAGTC -3'
(R):5'- GGCTATTTCCGAGGGATCTTTC -3'

Sequencing Primer
(F):5'- CCTGGTTACACAGTCAGTCAGTAAG -3'
(R):5'- GCCTTGCTATACTAGACTATCTGGG -3'
Posted On 2020-10-20