Incidental Mutation 'R8438:Srrt'
ID 654092
Institutional Source Beutler Lab
Gene Symbol Srrt
Ensembl Gene ENSMUSG00000037364
Gene Name serrate RNA effector molecule homolog (Arabidopsis)
Synonyms Asr2, Ars2, 2810019G02Rik
MMRRC Submission 067778-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8438 (G1)
Quality Score 210.009
Status Not validated
Chromosome 5
Chromosomal Location 137293966-137305936 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 137301262 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 55 (Y55N)
Ref Sequence ENSEMBL: ENSMUSP00000143232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040873] [ENSMUST00000196109] [ENSMUST00000197466] [ENSMUST00000197484] [ENSMUST00000198526] [ENSMUST00000199243]
AlphaFold Q99MR6
Predicted Effect unknown
Transcript: ENSMUST00000040873
AA Change: Y55N
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364
AA Change: Y55N

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196109
SMART Domains Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
Blast:RRM 65 133 2e-15 BLAST
low complexity region 208 237 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Pfam:ARS2 277 498 6.5e-111 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000197466
AA Change: Y55N
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364
AA Change: Y55N

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197484
SMART Domains Protein: ENSMUSP00000142660
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000198526
AA Change: Y55N
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364
AA Change: Y55N

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000199243
AA Change: Y55N
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364
AA Change: Y55N

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199365
Predicted Effect probably benign
Transcript: ENSMUST00000199605
Predicted Effect probably benign
Transcript: ENSMUST00000223263
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation, increased apoptosis, and when cultured most fail to hatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,201,962 (GRCm39) probably null Het
5730480H06Rik A T 5: 48,534,425 (GRCm39) H95L probably damaging Het
Abca8a A G 11: 109,966,404 (GRCm39) Y410H probably damaging Het
Abcb4 G A 5: 8,996,120 (GRCm39) probably null Het
Adam8 C T 7: 139,565,249 (GRCm39) probably null Het
Aldh1l1 C T 6: 90,536,428 (GRCm39) P111L probably damaging Het
Baz2b G T 2: 59,747,828 (GRCm39) Y1278* probably null Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Casp9 C A 4: 141,540,934 (GRCm39) T434N probably benign Het
Cd19 C A 7: 126,013,515 (GRCm39) M91I possibly damaging Het
Celsr2 G A 3: 108,301,139 (GRCm39) T2718M probably damaging Het
Clptm1 G T 7: 19,379,776 (GRCm39) D153E probably benign Het
Col1a2 G A 6: 4,515,517 (GRCm39) G127S unknown Het
Col1a2 G T 6: 4,515,518 (GRCm39) G127V unknown Het
Crybg3 A G 16: 59,385,655 (GRCm39) S190P probably benign Het
Ddrgk1 G A 2: 130,505,302 (GRCm39) probably benign Het
Dennd1a T C 2: 37,746,150 (GRCm39) H402R probably benign Het
Dgat2 T C 7: 98,806,207 (GRCm39) Y330C probably damaging Het
Dnah7b G A 1: 46,227,839 (GRCm39) C1354Y probably damaging Het
Ecd T A 14: 20,388,533 (GRCm39) I119L possibly damaging Het
Entpd1 A G 19: 40,725,224 (GRCm39) K437E possibly damaging Het
Fcgbp C T 7: 27,789,231 (GRCm39) A599V probably benign Het
Gtf3c1 G T 7: 125,241,701 (GRCm39) S1999* probably null Het
Hesx1 C T 14: 26,723,460 (GRCm39) R97C probably benign Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Hoxb3 A G 11: 96,236,609 (GRCm39) N229S probably benign Het
Itpk1 G A 12: 102,572,418 (GRCm39) probably benign Het
Itprid1 C T 6: 55,874,878 (GRCm39) S276L probably damaging Het
Masp1 T C 16: 23,289,153 (GRCm39) D549G probably benign Het
Mef2c A G 13: 83,804,336 (GRCm39) E312G probably damaging Het
Morn5 A G 2: 35,945,076 (GRCm39) K100R probably benign Het
Mphosph9 A T 5: 124,430,455 (GRCm39) D610E probably benign Het
Obox6 G C 7: 15,567,853 (GRCm39) A198G probably damaging Het
Or2t43 A T 11: 58,457,665 (GRCm39) S169T possibly damaging Het
Or4a75 C T 2: 89,448,054 (GRCm39) V161M possibly damaging Het
Or4a80 A T 2: 89,583,061 (GRCm39) M37K probably damaging Het
Or6b13 C A 7: 139,782,170 (GRCm39) C171F probably damaging Het
Pcdhgb2 A G 18: 37,825,232 (GRCm39) N741S probably benign Het
Plekhh2 A G 17: 84,877,379 (GRCm39) N575D probably benign Het
Plxna4 C A 6: 32,179,115 (GRCm39) G967W probably damaging Het
Ppp3cb C T 14: 20,565,658 (GRCm39) M373I probably damaging Het
Sec14l2 C A 11: 4,059,202 (GRCm39) E156* probably null Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,354,015 (GRCm39) probably benign Het
Thada G A 17: 84,743,057 (GRCm39) T789I probably damaging Het
Top3b G T 16: 16,709,364 (GRCm39) S684I probably benign Het
Trpc4 A G 3: 54,129,674 (GRCm39) I147V possibly damaging Het
Tubgcp5 T A 7: 55,454,363 (GRCm39) H219Q possibly damaging Het
Uck1 C A 2: 32,150,153 (GRCm39) probably benign Het
Vmn1r31 T A 6: 58,449,646 (GRCm39) D73V Het
Wasf3 A T 5: 146,390,237 (GRCm39) Q127L probably benign Het
Xpo6 T C 7: 125,760,054 (GRCm39) T182A possibly damaging Het
Xpo7 C A 14: 70,940,672 (GRCm39) R139S probably benign Het
Zfp687 A T 3: 94,915,433 (GRCm39) S1058T probably benign Het
Zfp786 T C 6: 47,796,934 (GRCm39) E668G probably damaging Het
Zfp831 A T 2: 174,486,796 (GRCm39) R490S possibly damaging Het
Other mutations in Srrt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Srrt APN 5 137,294,240 (GRCm39) unclassified probably benign
IGL01062:Srrt APN 5 137,294,569 (GRCm39) missense probably damaging 1.00
IGL02227:Srrt APN 5 137,294,536 (GRCm39) missense probably damaging 1.00
IGL02656:Srrt APN 5 137,297,938 (GRCm39) unclassified probably benign
IGL03105:Srrt APN 5 137,298,106 (GRCm39) missense possibly damaging 0.72
IGL03137:Srrt APN 5 137,294,379 (GRCm39) unclassified probably benign
R0281:Srrt UTSW 5 137,294,389 (GRCm39) unclassified probably benign
R0322:Srrt UTSW 5 137,294,870 (GRCm39) missense probably damaging 1.00
R0347:Srrt UTSW 5 137,297,938 (GRCm39) unclassified probably benign
R1253:Srrt UTSW 5 137,298,598 (GRCm39) missense probably benign 0.01
R1397:Srrt UTSW 5 137,298,523 (GRCm39) missense possibly damaging 0.89
R1520:Srrt UTSW 5 137,297,028 (GRCm39) missense probably damaging 0.99
R1561:Srrt UTSW 5 137,298,281 (GRCm39) missense probably benign 0.24
R1645:Srrt UTSW 5 137,300,401 (GRCm39) nonsense probably null
R1759:Srrt UTSW 5 137,301,212 (GRCm39) missense probably damaging 1.00
R1770:Srrt UTSW 5 137,298,122 (GRCm39) unclassified probably benign
R1795:Srrt UTSW 5 137,301,274 (GRCm39) unclassified probably benign
R1848:Srrt UTSW 5 137,295,207 (GRCm39) missense probably damaging 1.00
R3838:Srrt UTSW 5 137,300,387 (GRCm39) critical splice donor site probably null
R5015:Srrt UTSW 5 137,294,271 (GRCm39) missense probably damaging 1.00
R5068:Srrt UTSW 5 137,294,803 (GRCm39) missense possibly damaging 0.93
R5163:Srrt UTSW 5 137,295,035 (GRCm39) critical splice donor site probably null
R5316:Srrt UTSW 5 137,294,813 (GRCm39) missense probably benign 0.16
R5343:Srrt UTSW 5 137,295,427 (GRCm39) missense probably damaging 1.00
R5351:Srrt UTSW 5 137,296,546 (GRCm39) makesense probably null
R5412:Srrt UTSW 5 137,294,549 (GRCm39) missense probably damaging 1.00
R5806:Srrt UTSW 5 137,296,179 (GRCm39) missense probably damaging 0.98
R6470:Srrt UTSW 5 137,300,918 (GRCm39) missense probably damaging 1.00
R6497:Srrt UTSW 5 137,295,768 (GRCm39) missense probably damaging 1.00
R6755:Srrt UTSW 5 137,301,192 (GRCm39) missense probably damaging 1.00
R6828:Srrt UTSW 5 137,295,230 (GRCm39) missense probably damaging 1.00
R6875:Srrt UTSW 5 137,296,935 (GRCm39) missense probably benign 0.00
R7586:Srrt UTSW 5 137,300,457 (GRCm39) missense probably damaging 0.98
R7677:Srrt UTSW 5 137,298,410 (GRCm39) missense probably damaging 0.99
R8028:Srrt UTSW 5 137,300,760 (GRCm39) critical splice donor site probably benign
R8413:Srrt UTSW 5 137,298,589 (GRCm39) missense possibly damaging 0.84
R8795:Srrt UTSW 5 137,298,238 (GRCm39) missense probably benign 0.17
R8925:Srrt UTSW 5 137,297,070 (GRCm39) missense probably benign 0.26
R8927:Srrt UTSW 5 137,297,070 (GRCm39) missense probably benign 0.26
R9024:Srrt UTSW 5 137,301,291 (GRCm39) missense unknown
R9632:Srrt UTSW 5 137,296,689 (GRCm39) missense possibly damaging 0.79
R9667:Srrt UTSW 5 137,295,732 (GRCm39) missense probably damaging 0.96
R9793:Srrt UTSW 5 137,294,835 (GRCm39) missense probably benign 0.37
RF018:Srrt UTSW 5 137,298,262 (GRCm39) missense probably benign 0.23
Z1176:Srrt UTSW 5 137,296,489 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCACCCAAGGGATAAAAGGG -3'
(R):5'- TGCTGTCAGGCTACTGTTTC -3'

Sequencing Primer
(F):5'- TGTGTGGGATACTGAGGCAAG -3'
(R):5'- TCAGGCTACTGTTTCCTGTTG -3'
Posted On 2020-10-20