Incidental Mutation 'R8438:Xpo6'
ID654107
Institutional Source Beutler Lab
Gene Symbol Xpo6
Ensembl Gene ENSMUSG00000000131
Gene Nameexportin 6
Synonyms2610005L19Rik, C230091E20Rik, Ranbp20
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R8438 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location126101715-126200501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126160882 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 182 (T182A)
Ref Sequence ENSEMBL: ENSMUSP00000130527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009344] [ENSMUST00000167147] [ENSMUST00000168189]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009344
AA Change: T182A

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000009344
Gene: ENSMUSG00000000131
AA Change: T182A

DomainStartEndE-ValueType
IBN_N 31 97 4.04e-6 SMART
Pfam:Xpo1 103 290 1.4e-29 PFAM
low complexity region 469 484 N/A INTRINSIC
low complexity region 672 684 N/A INTRINSIC
low complexity region 1022 1034 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000132205
Gene: ENSMUSG00000000131
AA Change: T44A

DomainStartEndE-ValueType
Pfam:Xpo1 1 128 9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167147
Predicted Effect possibly damaging
Transcript: ENSMUST00000168189
AA Change: T182A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130527
Gene: ENSMUSG00000000131
AA Change: T182A

DomainStartEndE-ValueType
IBN_N 31 97 4.04e-6 SMART
Pfam:Xpo1 103 290 1.1e-25 PFAM
low complexity region 469 485 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,290,666 probably null Het
5730480H06Rik A T 5: 48,377,083 H95L probably damaging Het
Abca8a A G 11: 110,075,578 Y410H probably damaging Het
Abcb4 G A 5: 8,946,120 probably null Het
Adam8 C T 7: 139,985,336 probably null Het
Aldh1l1 C T 6: 90,559,446 P111L probably damaging Het
Baz2b G T 2: 59,917,484 Y1278* probably null Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp9 C A 4: 141,813,623 T434N probably benign Het
Ccdc129 C T 6: 55,897,893 S276L probably damaging Het
Cd19 C A 7: 126,414,343 M91I possibly damaging Het
Celsr2 G A 3: 108,393,823 T2718M probably damaging Het
Clptm1 G T 7: 19,645,851 D153E probably benign Het
Col1a2 G A 6: 4,515,517 G127S unknown Het
Col1a2 G T 6: 4,515,518 G127V unknown Het
Crybg3 A G 16: 59,565,292 S190P probably benign Het
Ddrgk1 G A 2: 130,663,382 probably benign Het
Dennd1a T C 2: 37,856,138 H402R probably benign Het
Dgat2 T C 7: 99,157,000 Y330C probably damaging Het
Dnah7b G A 1: 46,188,679 C1354Y probably damaging Het
Ecd T A 14: 20,338,465 I119L possibly damaging Het
Entpd1 A G 19: 40,736,780 K437E possibly damaging Het
Fcgbp C T 7: 28,089,806 A599V probably benign Het
Gtf3c1 G T 7: 125,642,529 S1999* probably null Het
Hesx1 C T 14: 27,001,503 R97C probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hoxb3 A G 11: 96,345,783 N229S probably benign Het
Itpk1 G A 12: 102,606,159 probably benign Het
Masp1 T C 16: 23,470,403 D549G probably benign Het
Mef2c A G 13: 83,656,217 E312G probably damaging Het
Morn5 A G 2: 36,055,064 K100R probably benign Het
Mphosph9 A T 5: 124,292,392 D610E probably benign Het
Obox6 G C 7: 15,833,928 A198G probably damaging Het
Olfr1248 C T 2: 89,617,710 V161M possibly damaging Het
Olfr1253 A T 2: 89,752,717 M37K probably damaging Het
Olfr224 A T 11: 58,566,839 S169T possibly damaging Het
Olfr524 C A 7: 140,202,257 C171F probably damaging Het
Pcdhgb2 A G 18: 37,692,179 N741S probably benign Het
Plekhh2 A G 17: 84,569,951 N575D probably benign Het
Plxna4 C A 6: 32,202,180 G967W probably damaging Het
Ppp3cb C T 14: 20,515,590 M373I probably damaging Het
Sec14l2 C A 11: 4,109,202 E156* probably null Het
Srrt A T 5: 137,303,000 Y55N unknown Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Thada G A 17: 84,435,629 T789I probably damaging Het
Top3b G T 16: 16,891,500 S684I probably benign Het
Trpc4 A G 3: 54,222,253 I147V possibly damaging Het
Tubgcp5 T A 7: 55,804,615 H219Q possibly damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Vmn1r31 T A 6: 58,472,661 D73V Het
Wasf3 A T 5: 146,453,427 Q127L probably benign Het
Xpo7 C A 14: 70,703,232 R139S probably benign Het
Zfp687 A T 3: 95,008,122 S1058T probably benign Het
Zfp786 T C 6: 47,820,000 E668G probably damaging Het
Zfp831 A T 2: 174,645,003 R490S possibly damaging Het
Other mutations in Xpo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Xpo6 APN 7 126129568 missense probably benign 0.03
IGL01432:Xpo6 APN 7 126124381 missense probably benign 0.31
IGL01627:Xpo6 APN 7 126149334 missense probably damaging 1.00
IGL01878:Xpo6 APN 7 126174193 missense probably benign 0.35
IGL02185:Xpo6 APN 7 126113808 splice site probably benign
IGL02744:Xpo6 APN 7 126108448 unclassified probably benign
IGL02927:Xpo6 APN 7 126156729 missense possibly damaging 0.86
IGL03216:Xpo6 APN 7 126104813 missense probably damaging 1.00
Cerise UTSW 7 126108844 missense probably damaging 1.00
Crayola UTSW 7 126107078 missense probably damaging 0.98
pastel UTSW 7 126108619 missense probably damaging 1.00
R7480_xpo6_742 UTSW 7 126102333 nonsense probably null
R0845:Xpo6 UTSW 7 126129543 splice site probably benign
R1671:Xpo6 UTSW 7 126108543 missense possibly damaging 0.92
R2349:Xpo6 UTSW 7 126113703 missense probably benign 0.18
R3051:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3052:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3053:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3902:Xpo6 UTSW 7 126120409 missense probably damaging 1.00
R4011:Xpo6 UTSW 7 126140608 missense probably benign 0.13
R4231:Xpo6 UTSW 7 126174182 missense possibly damaging 0.66
R4569:Xpo6 UTSW 7 126128255 missense probably damaging 1.00
R4604:Xpo6 UTSW 7 126113752 missense possibly damaging 0.52
R4736:Xpo6 UTSW 7 126140583 missense probably benign
R4919:Xpo6 UTSW 7 126152943 missense probably benign 0.01
R4953:Xpo6 UTSW 7 126169271 missense probably damaging 1.00
R5017:Xpo6 UTSW 7 126104747 missense probably benign 0.31
R5590:Xpo6 UTSW 7 126107078 missense probably damaging 0.98
R5856:Xpo6 UTSW 7 126149502 intron probably benign
R6077:Xpo6 UTSW 7 126109952 missense possibly damaging 0.67
R6156:Xpo6 UTSW 7 126108844 missense probably damaging 1.00
R6256:Xpo6 UTSW 7 126108619 missense probably damaging 1.00
R6481:Xpo6 UTSW 7 126112885 missense probably damaging 1.00
R6500:Xpo6 UTSW 7 126171090 intron probably benign
R7407:Xpo6 UTSW 7 126171052 missense probably damaging 0.99
R7480:Xpo6 UTSW 7 126102333 nonsense probably null
R7630:Xpo6 UTSW 7 126140389 splice site probably null
R7794:Xpo6 UTSW 7 126160863 missense probably damaging 0.98
R7984:Xpo6 UTSW 7 126120444 missense probably benign
R8022:Xpo6 UTSW 7 126169254 missense probably benign 0.04
R8283:Xpo6 UTSW 7 126128249 missense possibly damaging 0.90
X0012:Xpo6 UTSW 7 126169227 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTGAGGTTTTACCATGCACTAG -3'
(R):5'- GGCTCAACACTTCACTTTTAGTTG -3'

Sequencing Primer
(F):5'- TACCATGCACTAGACTGTGGC -3'
(R):5'- AGCTCATTAGTTCTATTCTGCTCAG -3'
Posted On2020-10-20