Incidental Mutation 'R8438:Sec14l2'
ID654113
Institutional Source Beutler Lab
Gene Symbol Sec14l2
Ensembl Gene ENSMUSG00000003585
Gene NameSEC14-like lipid binding 2
SynonymsSpf, tap, 1300013M05Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_144520.2; MGI:1915065

Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R8438 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location4097039-4123415 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 4109202 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 156 (E156*)
Ref Sequence ENSEMBL: ENSMUSP00000003681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003681]
Predicted Effect probably null
Transcript: ENSMUST00000003681
AA Change: E156*
SMART Domains Protein: ENSMUSP00000003681
Gene: ENSMUSG00000003585
AA Change: E156*

DomainStartEndE-ValueType
CRAL_TRIO_N 34 59 1.16e-6 SMART
SEC14 76 246 8.31e-62 SMART
Blast:SEC14 257 338 2e-42 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 3771069
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic protein which belongs to a family of lipid-binding proteins including Sec14p, alpha-tocopherol transfer protein, and cellular retinol-binding protein. The encoded protein stimulates squalene monooxygenase which is a downstream enzyme in the cholesterol biosynthetic pathway. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased cholesterol synthesis and plasma levels under fasting conditions compared to wild-type mice. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,290,666 probably null Het
5730480H06Rik A T 5: 48,377,083 H95L probably damaging Het
Abca8a A G 11: 110,075,578 Y410H probably damaging Het
Abcb4 G A 5: 8,946,120 probably null Het
Adam8 C T 7: 139,985,336 probably null Het
Aldh1l1 C T 6: 90,559,446 P111L probably damaging Het
Baz2b G T 2: 59,917,484 Y1278* probably null Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Casp9 C A 4: 141,813,623 T434N probably benign Het
Ccdc129 C T 6: 55,897,893 S276L probably damaging Het
Cd19 C A 7: 126,414,343 M91I possibly damaging Het
Celsr2 G A 3: 108,393,823 T2718M probably damaging Het
Clptm1 G T 7: 19,645,851 D153E probably benign Het
Col1a2 G A 6: 4,515,517 G127S unknown Het
Col1a2 G T 6: 4,515,518 G127V unknown Het
Crybg3 A G 16: 59,565,292 S190P probably benign Het
Ddrgk1 G A 2: 130,663,382 probably benign Het
Dennd1a T C 2: 37,856,138 H402R probably benign Het
Dgat2 T C 7: 99,157,000 Y330C probably damaging Het
Dnah7b G A 1: 46,188,679 C1354Y probably damaging Het
Ecd T A 14: 20,338,465 I119L possibly damaging Het
Entpd1 A G 19: 40,736,780 K437E possibly damaging Het
Fcgbp C T 7: 28,089,806 A599V probably benign Het
Gtf3c1 G T 7: 125,642,529 S1999* probably null Het
Hesx1 C T 14: 27,001,503 R97C probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hoxb3 A G 11: 96,345,783 N229S probably benign Het
Itpk1 G A 12: 102,606,159 probably benign Het
Masp1 T C 16: 23,470,403 D549G probably benign Het
Mef2c A G 13: 83,656,217 E312G probably damaging Het
Morn5 A G 2: 36,055,064 K100R probably benign Het
Mphosph9 A T 5: 124,292,392 D610E probably benign Het
Obox6 G C 7: 15,833,928 A198G probably damaging Het
Olfr1248 C T 2: 89,617,710 V161M possibly damaging Het
Olfr1253 A T 2: 89,752,717 M37K probably damaging Het
Olfr224 A T 11: 58,566,839 S169T possibly damaging Het
Olfr524 C A 7: 140,202,257 C171F probably damaging Het
Pcdhgb2 A G 18: 37,692,179 N741S probably benign Het
Plekhh2 A G 17: 84,569,951 N575D probably benign Het
Plxna4 C A 6: 32,202,180 G967W probably damaging Het
Ppp3cb C T 14: 20,515,590 M373I probably damaging Het
Srrt A T 5: 137,303,000 Y55N unknown Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Thada G A 17: 84,435,629 T789I probably damaging Het
Top3b G T 16: 16,891,500 S684I probably benign Het
Trpc4 A G 3: 54,222,253 I147V possibly damaging Het
Tubgcp5 T A 7: 55,804,615 H219Q possibly damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Vmn1r31 T A 6: 58,472,661 D73V Het
Wasf3 A T 5: 146,453,427 Q127L probably benign Het
Xpo6 T C 7: 126,160,882 T182A possibly damaging Het
Xpo7 C A 14: 70,703,232 R139S probably benign Het
Zfp687 A T 3: 95,008,122 S1058T probably benign Het
Zfp786 T C 6: 47,820,000 E668G probably damaging Het
Zfp831 A T 2: 174,645,003 R490S possibly damaging Het
Other mutations in Sec14l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Sec14l2 APN 11 4098317 missense probably benign
IGL01369:Sec14l2 APN 11 4103432 missense probably benign 0.03
IGL01404:Sec14l2 APN 11 4116710 missense possibly damaging 0.71
IGL01622:Sec14l2 APN 11 4103966 missense possibly damaging 0.58
IGL01623:Sec14l2 APN 11 4103966 missense possibly damaging 0.58
IGL02007:Sec14l2 APN 11 4111114 missense probably benign 0.00
IGL02632:Sec14l2 APN 11 4111222 missense probably benign 0.00
IGL02644:Sec14l2 APN 11 4103380 splice site probably benign
Samoas UTSW 11 4103980 missense possibly damaging 0.74
P0027:Sec14l2 UTSW 11 4103673 critical splice donor site probably null
PIT1430001:Sec14l2 UTSW 11 4109209 nonsense probably null
R0113:Sec14l2 UTSW 11 4103661 splice site probably benign
R1705:Sec14l2 UTSW 11 4103980 missense possibly damaging 0.74
R2044:Sec14l2 UTSW 11 4111435 splice site probably benign
R2180:Sec14l2 UTSW 11 4108964 missense probably damaging 1.00
R2215:Sec14l2 UTSW 11 4109169 missense probably damaging 1.00
R5301:Sec14l2 UTSW 11 4118727 start gained probably benign
R5668:Sec14l2 UTSW 11 4109189 missense probably damaging 1.00
R5949:Sec14l2 UTSW 11 4108972 missense probably damaging 1.00
R6050:Sec14l2 UTSW 11 4111477 missense probably benign 0.36
R6369:Sec14l2 UTSW 11 4103962 missense possibly damaging 0.69
R6467:Sec14l2 UTSW 11 4111161 missense probably damaging 1.00
R6798:Sec14l2 UTSW 11 4111213 missense probably damaging 1.00
R7142:Sec14l2 UTSW 11 4098379 missense probably benign 0.04
R7385:Sec14l2 UTSW 11 4116750 nonsense probably null
R7594:Sec14l2 UTSW 11 4111213 missense probably damaging 1.00
R7704:Sec14l2 UTSW 11 4108574 missense probably benign 0.19
T0722:Sec14l2 UTSW 11 4103673 critical splice donor site probably null
X0067:Sec14l2 UTSW 11 4116737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACGCTTCAGTGTTTCAGG -3'
(R):5'- GGTCAGTATCCCTCCATAGGTG -3'

Sequencing Primer
(F):5'- TCTTCAAACATGGTGAGGAACTAAG -3'
(R):5'- TGATACCTGCGTGTGAAAAACCTG -3'
Posted On2020-10-20