Incidental Mutation 'R0390:Klhdc10'
ID65412
Institutional Source Beutler Lab
Gene Symbol Klhdc10
Ensembl Gene ENSMUSG00000029775
Gene Namekelch domain containing 10
Synonyms
MMRRC Submission 038596-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R0390 (G1)
Quality Score128
Status Validated
Chromosome6
Chromosomal Location30401868-30455179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30447412 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 204 (I204T)
Ref Sequence ENSEMBL: ENSMUSP00000143839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068240] [ENSMUST00000068259] [ENSMUST00000123494] [ENSMUST00000132581] [ENSMUST00000144272]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068240
AA Change: I257T

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064594
Gene: ENSMUSG00000029775
AA Change: I257T

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
Pfam:Kelch_5 56 107 3.6e-7 PFAM
Pfam:Kelch_1 59 114 5.6e-8 PFAM
Pfam:Kelch_4 59 120 1.8e-7 PFAM
Pfam:Kelch_6 59 120 2.1e-8 PFAM
Pfam:Kelch_4 173 222 9.8e-9 PFAM
Pfam:Kelch_6 173 225 3.9e-9 PFAM
Pfam:Kelch_2 174 218 1.2e-7 PFAM
Pfam:Kelch_1 174 219 9.4e-8 PFAM
Kelch 239 294 4.93e0 SMART
Kelch 295 342 9.96e-4 SMART
low complexity region 373 384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068259
AA Change: I286T

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069669
Gene: ENSMUSG00000029775
AA Change: I286T

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
Pfam:Kelch_5 85 135 1.2e-7 PFAM
Pfam:Kelch_1 88 143 2.6e-8 PFAM
Pfam:Kelch_4 88 149 1.5e-6 PFAM
Pfam:Kelch_6 88 150 3.1e-8 PFAM
Pfam:Kelch_6 202 255 4.6e-9 PFAM
Pfam:Kelch_2 203 247 1.4e-7 PFAM
Pfam:Kelch_1 203 248 2.6e-6 PFAM
Kelch 268 323 4.93e0 SMART
Kelch 324 371 9.96e-4 SMART
low complexity region 402 413 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123494
AA Change: I146T

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145442
Gene: ENSMUSG00000029775
AA Change: I146T

DomainStartEndE-ValueType
Pfam:Kelch_4 62 110 1.2e-4 PFAM
Pfam:Kelch_6 62 115 5.2e-8 PFAM
Pfam:Kelch_2 63 107 1.6e-6 PFAM
Pfam:Kelch_1 63 108 3.1e-5 PFAM
Pfam:Kelch_1 116 157 2.1e-6 PFAM
Pfam:Kelch_6 116 157 8.8e-6 PFAM
Pfam:Kelch_4 122 157 3.7e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132581
AA Change: I204T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143839
Gene: ENSMUSG00000029775
AA Change: I204T

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
Pfam:Kelch_2 121 165 1.1e-6 PFAM
Pfam:Kelch_6 121 173 2.4e-8 PFAM
Pfam:Kelch_1 123 166 2.1e-5 PFAM
Pfam:Kelch_4 123 168 9.8e-5 PFAM
Kelch 186 241 1.7e-2 SMART
Kelch 242 289 3.3e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144272
AA Change: I146T

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145063
Gene: ENSMUSG00000029775
AA Change: I146T

DomainStartEndE-ValueType
Pfam:Kelch_4 62 110 3.5e-4 PFAM
Pfam:Kelch_6 62 115 1.6e-7 PFAM
Pfam:Kelch_2 63 107 4.8e-6 PFAM
Pfam:Kelch_1 63 108 9.1e-5 PFAM
Kelch 128 183 1.7e-2 SMART
Kelch 184 231 3.3e-6 SMART
low complexity region 262 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150854
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency 98% (110/112)
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik T A 18: 59,075,688 V136E probably damaging Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ap2m1 T C 16: 20,541,099 M183T probably damaging Het
Apob A T 12: 7,988,678 I364F probably damaging Het
Arl6 A T 16: 59,622,421 probably benign Het
Cand2 A G 6: 115,774,653 M15V possibly damaging Het
Cbl A G 9: 44,201,005 F131S probably damaging Het
Ccdc151 T A 9: 21,991,708 H442L probably benign Het
Ccdc74a A G 16: 17,650,476 S321G probably benign Het
Cdc14b T C 13: 64,210,192 probably benign Het
Cep152 T C 2: 125,576,869 probably benign Het
Cep290 A G 10: 100,508,758 E479G probably benign Het
Chrm2 T G 6: 36,524,111 I301R probably benign Het
Clec2e A G 6: 129,093,468 W197R probably damaging Het
Cnot10 G T 9: 114,629,150 S96* probably null Het
Col19a1 A G 1: 24,289,655 probably benign Het
Csmd2 T C 4: 128,133,673 probably benign Het
Cthrc1 A T 15: 39,086,764 *172L probably null Het
Cul9 A T 17: 46,528,589 I821N probably benign Het
Daam1 G C 12: 71,975,304 probably benign Het
Dhx58 A T 11: 100,699,264 I398N probably damaging Het
Dip2b T A 15: 100,193,913 H844Q probably damaging Het
Dmac2 A G 7: 25,621,029 D50G probably damaging Het
Dmxl1 C A 18: 49,879,362 Q1529K probably benign Het
Dtna C T 18: 23,597,501 P315L probably damaging Het
Ep300 T C 15: 81,640,116 S1382P unknown Het
Fat2 A T 11: 55,310,777 N490K probably damaging Het
Flg2 T A 3: 93,200,355 probably benign Het
Gm13084 T A 4: 143,811,699 D234V probably benign Het
Gpatch1 T C 7: 35,281,381 probably benign Het
Grin2a C A 16: 9,579,585 K879N possibly damaging Het
Hacd3 A C 9: 65,001,022 I164S possibly damaging Het
Hinfp A C 9: 44,298,948 C197G probably damaging Het
Hsd17b12 T C 2: 94,114,990 probably benign Het
Hsd3b1 A T 3: 98,853,039 L212Q probably damaging Het
Ifrd1 C T 12: 40,214,094 probably null Het
Igf2bp2 A G 16: 22,081,801 F129L possibly damaging Het
Kirrel3 T A 9: 35,020,163 I409N probably damaging Het
Kpna6 A T 4: 129,657,804 S65R possibly damaging Het
Lama3 A T 18: 12,407,563 D308V probably benign Het
Larp4b T A 13: 9,158,107 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyzl1 A T 18: 4,169,175 T11S probably benign Het
Man1c1 A G 4: 134,578,315 L366P probably damaging Het
Mef2a A G 7: 67,251,724 M100T probably damaging Het
Mettl13 G A 1: 162,538,889 H474Y possibly damaging Het
Mmp3 A G 9: 7,451,320 D352G probably benign Het
Mns1 T C 9: 72,452,804 I412T probably damaging Het
Mon2 T C 10: 123,007,021 D1501G probably null Het
Mylk G T 16: 34,875,620 G242W probably damaging Het
Nav1 T C 1: 135,449,966 D1715G possibly damaging Het
Nckap1l T C 15: 103,453,883 S2P probably damaging Het
Nek3 A T 8: 22,128,729 probably benign Het
Nfrkb A G 9: 31,388,897 probably benign Het
Nlrp4d T C 7: 10,388,778 D53G probably benign Het
Nol8 T C 13: 49,662,152 S561P probably damaging Het
Nuf2 A C 1: 169,525,297 probably benign Het
Ofcc1 T A 13: 40,015,313 D866V possibly damaging Het
Olfr195 A G 16: 59,149,299 I150V probably benign Het
Optn A G 2: 5,046,195 L125P probably benign Het
Otoa T A 7: 121,131,341 F588Y probably benign Het
Pappa T A 4: 65,351,613 probably null Het
Pde5a T G 3: 122,835,583 C635W probably damaging Het
Pdgfb A T 15: 80,003,419 probably null Het
Pih1d2 T A 9: 50,621,046 C135S probably damaging Het
Plcg1 G T 2: 160,752,366 C361F probably damaging Het
Ppp4r4 T C 12: 103,601,360 probably benign Het
Prdm10 G A 9: 31,349,268 probably null Het
Prex2 T A 1: 11,089,706 probably null Het
Prss56 T G 1: 87,184,730 probably null Het
Prtg A G 9: 72,844,958 K209E probably benign Het
Ptprc G A 1: 138,122,575 T36I possibly damaging Het
Rasgrp4 A G 7: 29,145,860 Y302C probably damaging Het
Rb1cc1 T A 1: 6,248,634 M759K probably damaging Het
Rbm15b T A 9: 106,885,998 M324L probably benign Het
Rcbtb2 T C 14: 73,178,547 V500A probably damaging Het
Rgs6 A G 12: 83,133,677 K434R probably damaging Het
Rims1 C T 1: 22,596,526 A125T possibly damaging Het
Robo3 A G 9: 37,422,177 V746A probably benign Het
Rtl1 C T 12: 109,591,386 E1340K unknown Het
Sacs G A 14: 61,205,640 D1712N possibly damaging Het
Samd4b G A 7: 28,403,977 P19S probably benign Het
Samhd1 T C 2: 157,114,231 Y347C probably damaging Het
Sema6d T A 2: 124,658,490 I393N probably damaging Het
Sigmar1 C T 4: 41,741,243 A4T probably benign Het
Skint9 C A 4: 112,389,179 L245F probably benign Het
Slc35f5 T C 1: 125,585,095 L372P probably damaging Het
Smc1b A T 15: 85,066,277 I1182N probably damaging Het
Smyd3 A G 1: 178,957,573 probably benign Het
Sptlc1 T C 13: 53,337,612 D417G probably benign Het
Sv2c T C 13: 96,088,708 N31S probably benign Het
Tjp1 T C 7: 65,314,990 D811G probably damaging Het
Top2b A G 14: 16,418,442 T1221A probably benign Het
Tph2 T C 10: 115,174,109 D182G probably damaging Het
Traf6 C T 2: 101,688,588 Q141* probably null Het
Ttn T C 2: 76,756,931 D21574G probably damaging Het
Uba2 T A 7: 34,151,021 N367I probably benign Het
Ube2b T C 11: 51,988,602 probably benign Het
Ubr5 G T 15: 38,030,672 L426I probably benign Het
Ugt2a2 T A 5: 87,464,148 H301L probably benign Het
Upf2 T A 2: 6,018,894 probably benign Het
Utrn T C 10: 12,710,060 D991G probably benign Het
Vmn2r25 T C 6: 123,823,181 D734G probably damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vwf T A 6: 125,626,361 Y891* probably null Het
Wwox C T 8: 114,706,278 T228I probably benign Het
Zer1 C T 2: 30,108,213 probably benign Het
Zfp180 C T 7: 24,104,707 H184Y possibly damaging Het
Zfp68 A T 5: 138,607,225 Y279N probably benign Het
Other mutations in Klhdc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Klhdc10 APN 6 30441934 splice site probably null
IGL02313:Klhdc10 APN 6 30439866 critical splice donor site probably null
IGL03353:Klhdc10 APN 6 30447992 splice site probably benign
PIT4378001:Klhdc10 UTSW 6 30447412 missense probably damaging 0.98
R0379:Klhdc10 UTSW 6 30450670 missense possibly damaging 0.89
R1199:Klhdc10 UTSW 6 30449494 missense probably damaging 1.00
R1628:Klhdc10 UTSW 6 30444462 missense probably damaging 0.98
R2243:Klhdc10 UTSW 6 30449559 missense probably damaging 1.00
R2861:Klhdc10 UTSW 6 30402140 missense unknown
R5007:Klhdc10 UTSW 6 30450641 missense probably benign 0.05
R5574:Klhdc10 UTSW 6 30439865 missense possibly damaging 0.92
R6428:Klhdc10 UTSW 6 30439856 missense probably damaging 1.00
R6724:Klhdc10 UTSW 6 30446641 missense probably damaging 0.99
R6842:Klhdc10 UTSW 6 30439782 missense probably damaging 1.00
R6879:Klhdc10 UTSW 6 30449590 missense probably damaging 1.00
R7014:Klhdc10 UTSW 6 30450503 missense probably damaging 1.00
R7124:Klhdc10 UTSW 6 30441827 missense probably damaging 1.00
R7453:Klhdc10 UTSW 6 30447990 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCTCACTCACTGTGGACATGTGAC -3'
(R):5'- TGTGCCGTGTAACCCAATAACCC -3'

Sequencing Primer
(F):5'- CCGGTCCAGGACAGCAC -3'
(R):5'- CAGGTGAAACCTCTCTGCTG -3'
Posted On2013-08-08