Incidental Mutation 'R8438:Hesx1'
ID 654121
Institutional Source Beutler Lab
Gene Symbol Hesx1
Ensembl Gene ENSMUSG00000040726
Gene Name homeobox gene expressed in ES cells
Synonyms Rpx, HES-1
MMRRC Submission 067778-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8438 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 26716375-26724286 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 26723460 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 97 (R97C)
Ref Sequence ENSEMBL: ENSMUSP00000041999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035433] [ENSMUST00000224331]
AlphaFold Q61658
Predicted Effect probably benign
Transcript: ENSMUST00000035433
AA Change: R97C

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041999
Gene: ENSMUSG00000040726
AA Change: R97C

DomainStartEndE-ValueType
HOX 108 170 2.68e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224331
AA Change: R97C

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved homeobox protein that is a transcriptional repressor in the developing forebrain and pituitary gland. Mutations in this gene are associated with septooptic dysplasia, HESX1-related growth hormone deficiency, and combined pituitary hormone deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice show significant perinatal and postnatal lethality. Deficiency is manifested as brain, endocrine/exocrine and sensory organ developmental abnormalities in many embryos. Most mice surviving past birth display eye defects such as anophthalmia or microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,201,962 (GRCm39) probably null Het
5730480H06Rik A T 5: 48,534,425 (GRCm39) H95L probably damaging Het
Abca8a A G 11: 109,966,404 (GRCm39) Y410H probably damaging Het
Abcb4 G A 5: 8,996,120 (GRCm39) probably null Het
Adam8 C T 7: 139,565,249 (GRCm39) probably null Het
Aldh1l1 C T 6: 90,536,428 (GRCm39) P111L probably damaging Het
Baz2b G T 2: 59,747,828 (GRCm39) Y1278* probably null Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Casp9 C A 4: 141,540,934 (GRCm39) T434N probably benign Het
Cd19 C A 7: 126,013,515 (GRCm39) M91I possibly damaging Het
Celsr2 G A 3: 108,301,139 (GRCm39) T2718M probably damaging Het
Clptm1 G T 7: 19,379,776 (GRCm39) D153E probably benign Het
Col1a2 G A 6: 4,515,517 (GRCm39) G127S unknown Het
Col1a2 G T 6: 4,515,518 (GRCm39) G127V unknown Het
Crybg3 A G 16: 59,385,655 (GRCm39) S190P probably benign Het
Ddrgk1 G A 2: 130,505,302 (GRCm39) probably benign Het
Dennd1a T C 2: 37,746,150 (GRCm39) H402R probably benign Het
Dgat2 T C 7: 98,806,207 (GRCm39) Y330C probably damaging Het
Dnah7b G A 1: 46,227,839 (GRCm39) C1354Y probably damaging Het
Ecd T A 14: 20,388,533 (GRCm39) I119L possibly damaging Het
Entpd1 A G 19: 40,725,224 (GRCm39) K437E possibly damaging Het
Fcgbp C T 7: 27,789,231 (GRCm39) A599V probably benign Het
Gtf3c1 G T 7: 125,241,701 (GRCm39) S1999* probably null Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Hoxb3 A G 11: 96,236,609 (GRCm39) N229S probably benign Het
Itpk1 G A 12: 102,572,418 (GRCm39) probably benign Het
Itprid1 C T 6: 55,874,878 (GRCm39) S276L probably damaging Het
Masp1 T C 16: 23,289,153 (GRCm39) D549G probably benign Het
Mef2c A G 13: 83,804,336 (GRCm39) E312G probably damaging Het
Morn5 A G 2: 35,945,076 (GRCm39) K100R probably benign Het
Mphosph9 A T 5: 124,430,455 (GRCm39) D610E probably benign Het
Obox6 G C 7: 15,567,853 (GRCm39) A198G probably damaging Het
Or2t43 A T 11: 58,457,665 (GRCm39) S169T possibly damaging Het
Or4a75 C T 2: 89,448,054 (GRCm39) V161M possibly damaging Het
Or4a80 A T 2: 89,583,061 (GRCm39) M37K probably damaging Het
Or6b13 C A 7: 139,782,170 (GRCm39) C171F probably damaging Het
Pcdhgb2 A G 18: 37,825,232 (GRCm39) N741S probably benign Het
Plekhh2 A G 17: 84,877,379 (GRCm39) N575D probably benign Het
Plxna4 C A 6: 32,179,115 (GRCm39) G967W probably damaging Het
Ppp3cb C T 14: 20,565,658 (GRCm39) M373I probably damaging Het
Sec14l2 C A 11: 4,059,202 (GRCm39) E156* probably null Het
Srrt A T 5: 137,301,262 (GRCm39) Y55N unknown Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,354,015 (GRCm39) probably benign Het
Thada G A 17: 84,743,057 (GRCm39) T789I probably damaging Het
Top3b G T 16: 16,709,364 (GRCm39) S684I probably benign Het
Trpc4 A G 3: 54,129,674 (GRCm39) I147V possibly damaging Het
Tubgcp5 T A 7: 55,454,363 (GRCm39) H219Q possibly damaging Het
Uck1 C A 2: 32,150,153 (GRCm39) probably benign Het
Vmn1r31 T A 6: 58,449,646 (GRCm39) D73V Het
Wasf3 A T 5: 146,390,237 (GRCm39) Q127L probably benign Het
Xpo6 T C 7: 125,760,054 (GRCm39) T182A possibly damaging Het
Xpo7 C A 14: 70,940,672 (GRCm39) R139S probably benign Het
Zfp687 A T 3: 94,915,433 (GRCm39) S1058T probably benign Het
Zfp786 T C 6: 47,796,934 (GRCm39) E668G probably damaging Het
Zfp831 A T 2: 174,486,796 (GRCm39) R490S possibly damaging Het
Other mutations in Hesx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Hesx1 APN 14 26,723,481 (GRCm39) missense probably benign 0.01
PIT4504001:Hesx1 UTSW 14 26,723,838 (GRCm39) missense probably benign 0.02
R0715:Hesx1 UTSW 14 26,722,809 (GRCm39) missense probably damaging 1.00
R1423:Hesx1 UTSW 14 26,723,876 (GRCm39) missense probably null 1.00
R1997:Hesx1 UTSW 14 26,723,340 (GRCm39) missense probably damaging 0.97
R2129:Hesx1 UTSW 14 26,722,802 (GRCm39) missense possibly damaging 0.63
R2155:Hesx1 UTSW 14 26,723,434 (GRCm39) missense probably benign 0.15
R2973:Hesx1 UTSW 14 26,722,599 (GRCm39) start gained probably benign
R5082:Hesx1 UTSW 14 26,722,731 (GRCm39) missense probably benign 0.06
R7181:Hesx1 UTSW 14 26,722,678 (GRCm39) start codon destroyed probably null 0.99
R7992:Hesx1 UTSW 14 26,723,379 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGAAACCTTGAAGAATTCCCTAG -3'
(R):5'- GAGTCCACCCTTTCACTAATGC -3'

Sequencing Primer
(F):5'- CCAGAACTTTGTGGAACATAGGC -3'
(R):5'- AATGCCACTTCTACACTGGG -3'
Posted On 2020-10-20