Incidental Mutation 'R8439:Kcnb2'
ID 654130
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Name potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms Kv2.2, 9630047L19Rik
MMRRC Submission 067883-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 15357478-15793974 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15382934 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 87 (Y87N)
Ref Sequence ENSEMBL: ENSMUSP00000126656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
AlphaFold A6H8H5
Predicted Effect probably damaging
Transcript: ENSMUST00000170146
AA Change: Y87N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000175681
AA Change: Y87N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: Y87N

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 79,841,995 (GRCm39) T1043S probably benign Het
Acadvl T A 11: 69,902,554 (GRCm39) K410* probably null Het
Adam8 C T 7: 139,567,762 (GRCm39) G354D probably benign Het
Ahctf1 T C 1: 179,590,175 (GRCm39) E1366G possibly damaging Het
Bahcc1 C A 11: 120,165,415 (GRCm39) Q949K probably benign Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Ccdc141 T A 2: 76,889,894 (GRCm39) Y466F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Cyp4a30b C A 4: 115,314,972 (GRCm39) Q185K probably benign Het
Dlx2 A T 2: 71,375,882 (GRCm39) I147K possibly damaging Het
Dnaaf6rt T A 1: 31,262,349 (GRCm39) D110E probably damaging Het
Dnaaf9 A G 2: 130,612,621 (GRCm39) L482S probably damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,979,841 (GRCm39) probably null Het
Dock7 C A 4: 98,971,266 (GRCm39) V100F Het
Dspp C A 5: 104,325,162 (GRCm39) D508E unknown Het
Duox2 G T 2: 122,128,636 (GRCm39) T4K probably benign Het
Ear1 T C 14: 44,056,704 (GRCm39) N55D probably damaging Het
Echdc1 G C 10: 29,210,242 (GRCm39) E179Q probably damaging Het
Ehbp1 T C 11: 22,046,109 (GRCm39) M547V possibly damaging Het
Erbb2 A G 11: 98,319,798 (GRCm39) N630S possibly damaging Het
Fam227a G A 15: 79,514,271 (GRCm39) S363L possibly damaging Het
Fam98b A G 2: 117,101,381 (GRCm39) R398G unknown Het
Fsip2 G A 2: 82,807,430 (GRCm39) D1250N probably benign Het
Gdnf G T 15: 7,864,134 (GRCm39) E182* probably null Het
Gys2 T C 6: 142,406,921 (GRCm39) H145R probably benign Het
Hcls1 A G 16: 36,767,003 (GRCm39) K69R probably benign Het
Itih5 A G 2: 10,239,869 (GRCm39) N332S probably benign Het
Lrriq3 A G 3: 154,893,873 (GRCm39) N525D probably damaging Het
Lsg1 A T 16: 30,380,569 (GRCm39) W623R probably damaging Het
Myo10 A G 15: 25,725,158 (GRCm39) Y243C probably benign Het
Nans T C 4: 46,492,814 (GRCm39) Y81H probably damaging Het
Nup54 T G 5: 92,573,605 (GRCm39) N199T probably benign Het
Or2h1 A G 17: 37,404,664 (GRCm39) L34P probably damaging Het
Or4c126 C T 2: 89,824,348 (GRCm39) L204F probably benign Het
Or4k15 T C 14: 50,364,604 (GRCm39) I190T probably benign Het
Or5w13 A T 2: 87,524,088 (GRCm39) I46N probably damaging Het
Or7d9 T A 9: 20,197,337 (GRCm39) L122* probably null Het
Pcnt G A 10: 76,256,039 (GRCm39) R734W probably damaging Het
Peg10 T C 6: 4,755,462 (GRCm39) F13L possibly damaging Het
Plcb1 T C 2: 135,091,972 (GRCm39) probably null Het
Ppfibp1 T C 6: 146,902,448 (GRCm39) V285A possibly damaging Het
Prpf39 T C 12: 65,102,036 (GRCm39) V371A possibly damaging Het
Psmb11 G A 14: 54,863,013 (GRCm39) C77Y probably damaging Het
Rrbp1 A G 2: 143,797,053 (GRCm39) L1133P probably benign Het
Slc16a1 G T 3: 104,560,149 (GRCm39) M151I probably benign Het
Tarm1 G T 7: 3,546,037 (GRCm39) Q89K possibly damaging Het
Tas2r116 T C 6: 132,832,540 (GRCm39) I47T probably damaging Het
Tmod3 T C 9: 75,436,680 (GRCm39) D85G probably damaging Het
Trbv14 T C 6: 41,112,299 (GRCm39) L32P probably benign Het
Trim16 T C 11: 62,741,414 (GRCm39) L486P probably benign Het
Trmt1l T G 1: 151,325,727 (GRCm39) S391A probably benign Het
Ush2a T A 1: 188,582,254 (GRCm39) N3772K probably damaging Het
Vmn1r230 G T 17: 21,066,870 (GRCm39) A20S probably benign Het
Wdr76 A G 2: 121,341,179 (GRCm39) N75D possibly damaging Het
Zfp977 A G 7: 42,230,102 (GRCm39) L141S probably benign Het
Zfp988 A G 4: 147,416,808 (GRCm39) D414G probably benign Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15,781,236 (GRCm39) missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15,383,147 (GRCm39) missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15,781,048 (GRCm39) missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15,383,178 (GRCm39) missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15,781,033 (GRCm39) missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15,780,085 (GRCm39) missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15,781,159 (GRCm39) missense probably benign
IGL02526:Kcnb2 APN 1 15,780,979 (GRCm39) missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15,780,730 (GRCm39) missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15,781,435 (GRCm39) missense probably benign
IGL03144:Kcnb2 APN 1 15,780,112 (GRCm39) missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15,383,200 (GRCm39) missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15,783,137 (GRCm39) unclassified probably benign
R0538:Kcnb2 UTSW 1 15,783,108 (GRCm39) unclassified probably benign
R0611:Kcnb2 UTSW 1 15,780,664 (GRCm39) missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15,781,012 (GRCm39) missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15,779,979 (GRCm39) missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15,779,990 (GRCm39) missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15,781,540 (GRCm39) missense possibly damaging 0.82
R2444:Kcnb2 UTSW 1 15,779,791 (GRCm39) missense probably benign
R3025:Kcnb2 UTSW 1 15,781,059 (GRCm39) missense possibly damaging 0.87
R3886:Kcnb2 UTSW 1 15,780,639 (GRCm39) missense probably damaging 1.00
R5010:Kcnb2 UTSW 1 15,383,186 (GRCm39) missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15,779,724 (GRCm39) missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15,781,068 (GRCm39) missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15,781,716 (GRCm39) missense probably benign
R5926:Kcnb2 UTSW 1 15,383,235 (GRCm39) missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15,780,790 (GRCm39) missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15,781,436 (GRCm39) missense probably benign
R6724:Kcnb2 UTSW 1 15,780,664 (GRCm39) missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15,780,480 (GRCm39) missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15,383,150 (GRCm39) missense probably benign
R7352:Kcnb2 UTSW 1 15,780,835 (GRCm39) missense probably benign
R7419:Kcnb2 UTSW 1 15,781,251 (GRCm39) missense possibly damaging 0.94
R7425:Kcnb2 UTSW 1 15,780,031 (GRCm39) missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15,383,064 (GRCm39) missense probably damaging 1.00
R7978:Kcnb2 UTSW 1 15,780,837 (GRCm39) missense probably benign 0.15
R7983:Kcnb2 UTSW 1 15,383,004 (GRCm39) missense probably damaging 0.98
R8115:Kcnb2 UTSW 1 15,781,851 (GRCm39) makesense probably null
R8156:Kcnb2 UTSW 1 15,780,280 (GRCm39) missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15,781,777 (GRCm39) missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15,780,876 (GRCm39) missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15,780,648 (GRCm39) missense probably benign 0.07
R9274:Kcnb2 UTSW 1 15,781,723 (GRCm39) missense probably benign
R9321:Kcnb2 UTSW 1 15,779,793 (GRCm39) missense possibly damaging 0.46
R9563:Kcnb2 UTSW 1 15,779,737 (GRCm39) missense probably damaging 1.00
R9633:Kcnb2 UTSW 1 15,781,444 (GRCm39) missense probably benign
R9709:Kcnb2 UTSW 1 15,780,523 (GRCm39) missense probably benign 0.31
V7580:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15,781,252 (GRCm39) missense probably benign 0.01
Z1088:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.03
Z1177:Kcnb2 UTSW 1 15,781,182 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGAACAGAAAGACATCCAGGTC -3'
(R):5'- ATGGTATCTGGCTTGGCAGC -3'

Sequencing Primer
(F):5'- TCCAGAACCTGTGGACATTATC -3'
(R):5'- GCAGGACTCTAGGTAGATCTCATC -3'
Posted On 2020-10-20