Incidental Mutation 'R8439:Kcnb2'
ID 654130
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Name potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms 9630047L19Rik, Kv2.2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 15287254-15723750 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15312710 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 87 (Y87N)
Ref Sequence ENSEMBL: ENSMUSP00000126656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
AlphaFold A6H8H5
Predicted Effect probably damaging
Transcript: ENSMUST00000170146
AA Change: Y87N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000175681
AA Change: Y87N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: Y87N

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,770,701 L482S probably damaging Het
Abca7 A T 10: 80,006,161 T1043S probably benign Het
Acadvl T A 11: 70,011,728 K410* probably null Het
Adam8 C T 7: 139,987,849 G354D probably benign Het
Ahctf1 T C 1: 179,762,610 E1366G possibly damaging Het
Bahcc1 C A 11: 120,274,589 Q949K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Ccdc141 T A 2: 77,059,550 Y466F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cyp4a30b C A 4: 115,457,775 Q185K probably benign Het
Dlx2 A T 2: 71,545,538 I147K possibly damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dock7 C A 4: 99,083,029 V100F Het
Dspp C A 5: 104,177,296 D508E unknown Het
Duox2 G T 2: 122,298,155 T4K probably benign Het
Ear1 T C 14: 43,819,247 N55D probably damaging Het
Echdc1 G C 10: 29,334,246 E179Q probably damaging Het
Ehbp1 T C 11: 22,096,109 M547V possibly damaging Het
Erbb2 A G 11: 98,428,972 N630S possibly damaging Het
Fam227a G A 15: 79,630,070 S363L possibly damaging Het
Fam98b A G 2: 117,270,900 R398G unknown Het
Fsip2 G A 2: 82,977,086 D1250N probably benign Het
Gdnf G T 15: 7,834,653 E182* probably null Het
Gys2 T C 6: 142,461,195 H145R probably benign Het
Hcls1 A G 16: 36,946,641 K69R probably benign Het
Itih5 A G 2: 10,235,058 N332S probably benign Het
Lrriq3 A G 3: 155,188,236 N525D probably damaging Het
Lsg1 A T 16: 30,561,751 W623R probably damaging Het
Myo10 A G 15: 25,725,072 Y243C probably benign Het
Nans T C 4: 46,492,814 Y81H probably damaging Het
Nup54 T G 5: 92,425,746 N199T probably benign Het
Olfr1136 A T 2: 87,693,744 I46N probably damaging Het
Olfr1261 C T 2: 89,994,004 L204F probably benign Het
Olfr39 T A 9: 20,286,041 L122* probably null Het
Olfr727 T C 14: 50,127,147 I190T probably benign Het
Olfr91 A G 17: 37,093,772 L34P probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Peg10 T C 6: 4,755,462 F13L possibly damaging Het
Pih1d3 T A 1: 31,223,268 D110E probably damaging Het
Plcb1 T C 2: 135,250,052 probably null Het
Ppfibp1 T C 6: 147,000,950 V285A possibly damaging Het
Prpf39 T C 12: 65,055,262 V371A possibly damaging Het
Psmb11 G A 14: 54,625,556 C77Y probably damaging Het
Rrbp1 A G 2: 143,955,133 L1133P probably benign Het
Slc16a1 G T 3: 104,652,833 M151I probably benign Het
Tarm1 G T 7: 3,497,521 Q89K possibly damaging Het
Tas2r116 T C 6: 132,855,577 I47T probably damaging Het
Tmod3 T C 9: 75,529,398 D85G probably damaging Het
Trbv14 T C 6: 41,135,365 L32P probably benign Het
Trim16 T C 11: 62,850,588 L486P probably benign Het
Trmt1l T G 1: 151,449,976 S391A probably benign Het
Ush2a T A 1: 188,850,057 N3772K probably damaging Het
Vmn1r230 G T 17: 20,846,608 A20S probably benign Het
Wdr76 A G 2: 121,510,698 N75D possibly damaging Het
Zfp977 A G 7: 42,580,678 L141S probably benign Het
Zfp988 A G 4: 147,332,351 D414G probably benign Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15711012 missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15312923 missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15710824 missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15312954 missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15710809 missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15709861 missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15710935 missense probably benign
IGL02526:Kcnb2 APN 1 15710755 missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15710506 missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15711211 missense probably benign
IGL03144:Kcnb2 APN 1 15709888 missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15312976 missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15712913 unclassified probably benign
R0538:Kcnb2 UTSW 1 15712884 unclassified probably benign
R0611:Kcnb2 UTSW 1 15710440 missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15710788 missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15709755 missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15709766 missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15711316 missense possibly damaging 0.82
R2444:Kcnb2 UTSW 1 15709567 missense probably benign
R3025:Kcnb2 UTSW 1 15710835 missense possibly damaging 0.87
R3886:Kcnb2 UTSW 1 15710415 missense probably damaging 1.00
R5010:Kcnb2 UTSW 1 15312962 missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15709500 missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15710844 missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15711492 missense probably benign
R5926:Kcnb2 UTSW 1 15313011 missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15710566 missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15711212 missense probably benign
R6724:Kcnb2 UTSW 1 15710440 missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15710256 missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15312926 missense probably benign
R7352:Kcnb2 UTSW 1 15710611 missense probably benign
R7419:Kcnb2 UTSW 1 15711027 missense possibly damaging 0.94
R7425:Kcnb2 UTSW 1 15709807 missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15312840 missense probably damaging 1.00
R7978:Kcnb2 UTSW 1 15710613 missense probably benign 0.15
R7983:Kcnb2 UTSW 1 15312780 missense probably damaging 0.98
R8115:Kcnb2 UTSW 1 15711627 makesense probably null
R8156:Kcnb2 UTSW 1 15710056 missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15711553 missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15710652 missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15710424 missense probably benign 0.07
R9274:Kcnb2 UTSW 1 15711499 missense probably benign
R9321:Kcnb2 UTSW 1 15709569 missense possibly damaging 0.46
R9563:Kcnb2 UTSW 1 15709513 missense probably damaging 1.00
R9633:Kcnb2 UTSW 1 15711220 missense probably benign
R9709:Kcnb2 UTSW 1 15710299 missense probably benign 0.31
V7580:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15710091 missense probably benign 0.03
Z1088:Kcnb2 UTSW 1 15711028 missense probably benign 0.01
Z1177:Kcnb2 UTSW 1 15710958 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGAACAGAAAGACATCCAGGTC -3'
(R):5'- ATGGTATCTGGCTTGGCAGC -3'

Sequencing Primer
(F):5'- TCCAGAACCTGTGGACATTATC -3'
(R):5'- GCAGGACTCTAGGTAGATCTCATC -3'
Posted On 2020-10-20