Incidental Mutation 'R8439:Trmt1l'
ID 654132
Institutional Source Beutler Lab
Gene Symbol Trmt1l
Ensembl Gene ENSMUSG00000053286
Gene Name tRNA methyltransferase 1 like
Synonyms 1190005F20Rik, Trm1-like
MMRRC Submission 067883-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 151304293-151333912 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 151325727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 391 (S391A)
Ref Sequence ENSEMBL: ENSMUSP00000068309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000065625
AA Change: S391A

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: S391A

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189655
SMART Domains Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

DomainStartEndE-ValueType
ZnF_C2H2 28 50 1.1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 79,841,995 (GRCm39) T1043S probably benign Het
Acadvl T A 11: 69,902,554 (GRCm39) K410* probably null Het
Adam8 C T 7: 139,567,762 (GRCm39) G354D probably benign Het
Ahctf1 T C 1: 179,590,175 (GRCm39) E1366G possibly damaging Het
Bahcc1 C A 11: 120,165,415 (GRCm39) Q949K probably benign Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Ccdc141 T A 2: 76,889,894 (GRCm39) Y466F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Cyp4a30b C A 4: 115,314,972 (GRCm39) Q185K probably benign Het
Dlx2 A T 2: 71,375,882 (GRCm39) I147K possibly damaging Het
Dnaaf6rt T A 1: 31,262,349 (GRCm39) D110E probably damaging Het
Dnaaf9 A G 2: 130,612,621 (GRCm39) L482S probably damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,979,841 (GRCm39) probably null Het
Dock7 C A 4: 98,971,266 (GRCm39) V100F Het
Dspp C A 5: 104,325,162 (GRCm39) D508E unknown Het
Duox2 G T 2: 122,128,636 (GRCm39) T4K probably benign Het
Ear1 T C 14: 44,056,704 (GRCm39) N55D probably damaging Het
Echdc1 G C 10: 29,210,242 (GRCm39) E179Q probably damaging Het
Ehbp1 T C 11: 22,046,109 (GRCm39) M547V possibly damaging Het
Erbb2 A G 11: 98,319,798 (GRCm39) N630S possibly damaging Het
Fam227a G A 15: 79,514,271 (GRCm39) S363L possibly damaging Het
Fam98b A G 2: 117,101,381 (GRCm39) R398G unknown Het
Fsip2 G A 2: 82,807,430 (GRCm39) D1250N probably benign Het
Gdnf G T 15: 7,864,134 (GRCm39) E182* probably null Het
Gys2 T C 6: 142,406,921 (GRCm39) H145R probably benign Het
Hcls1 A G 16: 36,767,003 (GRCm39) K69R probably benign Het
Itih5 A G 2: 10,239,869 (GRCm39) N332S probably benign Het
Kcnb2 T A 1: 15,382,934 (GRCm39) Y87N probably damaging Het
Lrriq3 A G 3: 154,893,873 (GRCm39) N525D probably damaging Het
Lsg1 A T 16: 30,380,569 (GRCm39) W623R probably damaging Het
Myo10 A G 15: 25,725,158 (GRCm39) Y243C probably benign Het
Nans T C 4: 46,492,814 (GRCm39) Y81H probably damaging Het
Nup54 T G 5: 92,573,605 (GRCm39) N199T probably benign Het
Or2h1 A G 17: 37,404,664 (GRCm39) L34P probably damaging Het
Or4c126 C T 2: 89,824,348 (GRCm39) L204F probably benign Het
Or4k15 T C 14: 50,364,604 (GRCm39) I190T probably benign Het
Or5w13 A T 2: 87,524,088 (GRCm39) I46N probably damaging Het
Or7d9 T A 9: 20,197,337 (GRCm39) L122* probably null Het
Pcnt G A 10: 76,256,039 (GRCm39) R734W probably damaging Het
Peg10 T C 6: 4,755,462 (GRCm39) F13L possibly damaging Het
Plcb1 T C 2: 135,091,972 (GRCm39) probably null Het
Ppfibp1 T C 6: 146,902,448 (GRCm39) V285A possibly damaging Het
Prpf39 T C 12: 65,102,036 (GRCm39) V371A possibly damaging Het
Psmb11 G A 14: 54,863,013 (GRCm39) C77Y probably damaging Het
Rrbp1 A G 2: 143,797,053 (GRCm39) L1133P probably benign Het
Slc16a1 G T 3: 104,560,149 (GRCm39) M151I probably benign Het
Tarm1 G T 7: 3,546,037 (GRCm39) Q89K possibly damaging Het
Tas2r116 T C 6: 132,832,540 (GRCm39) I47T probably damaging Het
Tmod3 T C 9: 75,436,680 (GRCm39) D85G probably damaging Het
Trbv14 T C 6: 41,112,299 (GRCm39) L32P probably benign Het
Trim16 T C 11: 62,741,414 (GRCm39) L486P probably benign Het
Ush2a T A 1: 188,582,254 (GRCm39) N3772K probably damaging Het
Vmn1r230 G T 17: 21,066,870 (GRCm39) A20S probably benign Het
Wdr76 A G 2: 121,341,179 (GRCm39) N75D possibly damaging Het
Zfp977 A G 7: 42,230,102 (GRCm39) L141S probably benign Het
Zfp988 A G 4: 147,416,808 (GRCm39) D414G probably benign Het
Other mutations in Trmt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Trmt1l APN 1 151,318,463 (GRCm39) critical splice donor site probably null
IGL02175:Trmt1l APN 1 151,324,235 (GRCm39) missense probably benign 0.00
IGL02348:Trmt1l APN 1 151,325,757 (GRCm39) missense probably damaging 1.00
IGL02397:Trmt1l APN 1 151,315,282 (GRCm39) missense probably damaging 1.00
IGL02582:Trmt1l APN 1 151,309,536 (GRCm39) splice site probably benign
IGL03150:Trmt1l APN 1 151,329,643 (GRCm39) missense probably benign 0.00
IGL03220:Trmt1l APN 1 151,316,692 (GRCm39) splice site probably benign
Canyonlands UTSW 1 151,329,799 (GRCm39) nonsense probably null
splendiforous UTSW 1 151,328,899 (GRCm39) missense probably damaging 1.00
IGL03014:Trmt1l UTSW 1 151,333,681 (GRCm39) missense probably damaging 0.99
R0067:Trmt1l UTSW 1 151,324,131 (GRCm39) missense probably benign 0.16
R0067:Trmt1l UTSW 1 151,324,131 (GRCm39) missense probably benign 0.16
R0240:Trmt1l UTSW 1 151,333,205 (GRCm39) unclassified probably benign
R0267:Trmt1l UTSW 1 151,333,426 (GRCm39) unclassified probably benign
R2084:Trmt1l UTSW 1 151,316,605 (GRCm39) missense probably damaging 1.00
R2206:Trmt1l UTSW 1 151,311,594 (GRCm39) critical splice donor site probably null
R2338:Trmt1l UTSW 1 151,304,710 (GRCm39) intron probably benign
R2408:Trmt1l UTSW 1 151,315,267 (GRCm39) missense possibly damaging 0.48
R2429:Trmt1l UTSW 1 151,309,581 (GRCm39) missense probably damaging 1.00
R2520:Trmt1l UTSW 1 151,329,696 (GRCm39) missense probably benign 0.14
R3972:Trmt1l UTSW 1 151,309,634 (GRCm39) missense possibly damaging 0.91
R4092:Trmt1l UTSW 1 151,330,784 (GRCm39) missense probably benign 0.18
R4361:Trmt1l UTSW 1 151,311,626 (GRCm39) intron probably benign
R4411:Trmt1l UTSW 1 151,327,905 (GRCm39) missense probably benign 0.02
R4419:Trmt1l UTSW 1 151,316,559 (GRCm39) missense probably damaging 0.98
R4518:Trmt1l UTSW 1 151,324,094 (GRCm39) nonsense probably null
R4614:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4617:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4618:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4647:Trmt1l UTSW 1 151,333,632 (GRCm39) missense possibly damaging 0.86
R4653:Trmt1l UTSW 1 151,315,320 (GRCm39) missense probably benign 0.00
R4734:Trmt1l UTSW 1 151,318,388 (GRCm39) missense probably benign 0.32
R4873:Trmt1l UTSW 1 151,330,755 (GRCm39) missense probably benign 0.04
R4875:Trmt1l UTSW 1 151,330,755 (GRCm39) missense probably benign 0.04
R5026:Trmt1l UTSW 1 151,316,627 (GRCm39) missense probably damaging 1.00
R5528:Trmt1l UTSW 1 151,330,746 (GRCm39) missense probably benign
R5587:Trmt1l UTSW 1 151,311,455 (GRCm39) intron probably benign
R5872:Trmt1l UTSW 1 151,316,594 (GRCm39) missense probably damaging 1.00
R6060:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
R6169:Trmt1l UTSW 1 151,304,704 (GRCm39) intron probably benign
R6333:Trmt1l UTSW 1 151,329,685 (GRCm39) missense probably benign 0.15
R6906:Trmt1l UTSW 1 151,327,926 (GRCm39) missense probably benign 0.03
R7269:Trmt1l UTSW 1 151,333,539 (GRCm39) missense possibly damaging 0.81
R7574:Trmt1l UTSW 1 151,316,591 (GRCm39) missense possibly damaging 0.95
R7740:Trmt1l UTSW 1 151,316,639 (GRCm39) missense possibly damaging 0.47
R7760:Trmt1l UTSW 1 151,318,425 (GRCm39) missense possibly damaging 0.93
R7984:Trmt1l UTSW 1 151,311,489 (GRCm39) missense probably benign 0.02
R8257:Trmt1l UTSW 1 151,304,629 (GRCm39) start codon destroyed probably null
R8286:Trmt1l UTSW 1 151,333,543 (GRCm39) missense probably damaging 1.00
R8451:Trmt1l UTSW 1 151,324,039 (GRCm39) missense unknown
R8514:Trmt1l UTSW 1 151,329,742 (GRCm39) missense probably damaging 0.98
R9287:Trmt1l UTSW 1 151,328,899 (GRCm39) missense probably damaging 1.00
R9423:Trmt1l UTSW 1 151,325,817 (GRCm39) missense possibly damaging 0.90
R9622:Trmt1l UTSW 1 151,304,710 (GRCm39) nonsense probably null
X0039:Trmt1l UTSW 1 151,330,741 (GRCm39) missense possibly damaging 0.88
Z1176:Trmt1l UTSW 1 151,328,864 (GRCm39) missense possibly damaging 0.72
Z1187:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1189:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1190:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1192:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGCAAACGTTGAATCCATGATT -3'
(R):5'- ATAGTAGGTGCACCATTGGC -3'

Sequencing Primer
(F):5'- GGATCTCACTTTGTAGACCAGGC -3'
(R):5'- GCACCATTGGCAGTTTGGTACC -3'
Posted On 2020-10-20