Incidental Mutation 'R8439:Itih5'
ID 654135
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha (globulin) inhibitor H5
Synonyms 5430408M01Rik, 4631408O11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 10153571-10256529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10235058 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 332 (N332S)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
AA Change: N332S

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: N332S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,770,701 L482S probably damaging Het
Abca7 A T 10: 80,006,161 T1043S probably benign Het
Acadvl T A 11: 70,011,728 K410* probably null Het
Adam8 C T 7: 139,987,849 G354D probably benign Het
Ahctf1 T C 1: 179,762,610 E1366G possibly damaging Het
Bahcc1 C A 11: 120,274,589 Q949K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Ccdc141 T A 2: 77,059,550 Y466F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cyp4a30b C A 4: 115,457,775 Q185K probably benign Het
Dlx2 A T 2: 71,545,538 I147K possibly damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dock7 C A 4: 99,083,029 V100F Het
Dspp C A 5: 104,177,296 D508E unknown Het
Duox2 G T 2: 122,298,155 T4K probably benign Het
Ear1 T C 14: 43,819,247 N55D probably damaging Het
Echdc1 G C 10: 29,334,246 E179Q probably damaging Het
Ehbp1 T C 11: 22,096,109 M547V possibly damaging Het
Erbb2 A G 11: 98,428,972 N630S possibly damaging Het
Fam227a G A 15: 79,630,070 S363L possibly damaging Het
Fam98b A G 2: 117,270,900 R398G unknown Het
Fsip2 G A 2: 82,977,086 D1250N probably benign Het
Gdnf G T 15: 7,834,653 E182* probably null Het
Gys2 T C 6: 142,461,195 H145R probably benign Het
Hcls1 A G 16: 36,946,641 K69R probably benign Het
Kcnb2 T A 1: 15,312,710 Y87N probably damaging Het
Lrriq3 A G 3: 155,188,236 N525D probably damaging Het
Lsg1 A T 16: 30,561,751 W623R probably damaging Het
Myo10 A G 15: 25,725,072 Y243C probably benign Het
Nans T C 4: 46,492,814 Y81H probably damaging Het
Nup54 T G 5: 92,425,746 N199T probably benign Het
Olfr1136 A T 2: 87,693,744 I46N probably damaging Het
Olfr1261 C T 2: 89,994,004 L204F probably benign Het
Olfr39 T A 9: 20,286,041 L122* probably null Het
Olfr727 T C 14: 50,127,147 I190T probably benign Het
Olfr91 A G 17: 37,093,772 L34P probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Peg10 T C 6: 4,755,462 F13L possibly damaging Het
Pih1d3 T A 1: 31,223,268 D110E probably damaging Het
Plcb1 T C 2: 135,250,052 probably null Het
Ppfibp1 T C 6: 147,000,950 V285A possibly damaging Het
Prpf39 T C 12: 65,055,262 V371A possibly damaging Het
Psmb11 G A 14: 54,625,556 C77Y probably damaging Het
Rrbp1 A G 2: 143,955,133 L1133P probably benign Het
Slc16a1 G T 3: 104,652,833 M151I probably benign Het
Tarm1 G T 7: 3,497,521 Q89K possibly damaging Het
Tas2r116 T C 6: 132,855,577 I47T probably damaging Het
Tmod3 T C 9: 75,529,398 D85G probably damaging Het
Trbv14 T C 6: 41,135,365 L32P probably benign Het
Trim16 T C 11: 62,850,588 L486P probably benign Het
Trmt1l T G 1: 151,449,976 S391A probably benign Het
Ush2a T A 1: 188,850,057 N3772K probably damaging Het
Vmn1r230 G T 17: 20,846,608 A20S probably benign Het
Wdr76 A G 2: 121,510,698 N75D possibly damaging Het
Zfp977 A G 7: 42,580,678 L141S probably benign Het
Zfp988 A G 4: 147,332,351 D414G probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0158:Itih5 UTSW 2 10234992 splice site probably benign
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0905:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1104:Itih5 UTSW 2 10251512 missense probably benign 0.03
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3684:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 splice site probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R6662:Itih5 UTSW 2 10249181 missense probably benign 0.13
R7019:Itih5 UTSW 2 10190327 missense probably damaging 1.00
R7068:Itih5 UTSW 2 10249304 missense probably damaging 0.99
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7424:Itih5 UTSW 2 10245637 missense probably damaging 1.00
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
R8025:Itih5 UTSW 2 10241022 missense probably benign 0.13
R8253:Itih5 UTSW 2 10238595 missense probably benign 0.06
R8349:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8449:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8825:Itih5 UTSW 2 10190420 missense probably benign 0.00
R9110:Itih5 UTSW 2 10187020 missense probably benign
R9582:Itih5 UTSW 2 10190202 missense probably benign 0.07
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTAGACCATGTTCCAGCAGGG -3'
(R):5'- TAGTATCAGCGCCAACTCCC -3'

Sequencing Primer
(F):5'- ATGTTCCAGCAGGGCAGAC -3'
(R):5'- GCCAACTCCCAAAGTCTTGTC -3'
Posted On 2020-10-20