Incidental Mutation 'R8439:Fsip2'
ID 654138
Institutional Source Beutler Lab
Gene Symbol Fsip2
Ensembl Gene ENSMUSG00000075249
Gene Name fibrous sheath-interacting protein 2
Synonyms OTTMUSG00000013335
MMRRC Submission 067883-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R8439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 82773978-82839281 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 82807430 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1250 (D1250N)
Ref Sequence ENSEMBL: ENSMUSP00000120314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143764]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000132967
SMART Domains Protein: ENSMUSP00000122350
Gene: ENSMUSG00000075249

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
low complexity region 953 962 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143764
AA Change: D1250N

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249
AA Change: D1250N

DomainStartEndE-ValueType
coiled coil region 271 297 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1115 1120 N/A INTRINSIC
low complexity region 1531 1545 N/A INTRINSIC
low complexity region 2044 2057 N/A INTRINSIC
low complexity region 2507 2523 N/A INTRINSIC
low complexity region 2564 2575 N/A INTRINSIC
low complexity region 2866 2877 N/A INTRINSIC
low complexity region 2896 2915 N/A INTRINSIC
low complexity region 3220 3231 N/A INTRINSIC
low complexity region 3438 3447 N/A INTRINSIC
Pfam:FSIP2 4045 4408 3.5e-42 PFAM
Pfam:FSIP2 4375 4613 7.7e-26 PFAM
Pfam:FSIP2 4622 4932 4.3e-17 PFAM
Pfam:FSIP2 4903 5454 7e-27 PFAM
low complexity region 5507 5522 N/A INTRINSIC
low complexity region 5769 5780 N/A INTRINSIC
low complexity region 5834 5846 N/A INTRINSIC
low complexity region 5851 5867 N/A INTRINSIC
Pfam:FSIP2 5998 6867 N/A PFAM
low complexity region 6977 6990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 79,841,995 (GRCm39) T1043S probably benign Het
Acadvl T A 11: 69,902,554 (GRCm39) K410* probably null Het
Adam8 C T 7: 139,567,762 (GRCm39) G354D probably benign Het
Ahctf1 T C 1: 179,590,175 (GRCm39) E1366G possibly damaging Het
Bahcc1 C A 11: 120,165,415 (GRCm39) Q949K probably benign Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Ccdc141 T A 2: 76,889,894 (GRCm39) Y466F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Cyp4a30b C A 4: 115,314,972 (GRCm39) Q185K probably benign Het
Dlx2 A T 2: 71,375,882 (GRCm39) I147K possibly damaging Het
Dnaaf6rt T A 1: 31,262,349 (GRCm39) D110E probably damaging Het
Dnaaf9 A G 2: 130,612,621 (GRCm39) L482S probably damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,979,841 (GRCm39) probably null Het
Dock7 C A 4: 98,971,266 (GRCm39) V100F Het
Dspp C A 5: 104,325,162 (GRCm39) D508E unknown Het
Duox2 G T 2: 122,128,636 (GRCm39) T4K probably benign Het
Ear1 T C 14: 44,056,704 (GRCm39) N55D probably damaging Het
Echdc1 G C 10: 29,210,242 (GRCm39) E179Q probably damaging Het
Ehbp1 T C 11: 22,046,109 (GRCm39) M547V possibly damaging Het
Erbb2 A G 11: 98,319,798 (GRCm39) N630S possibly damaging Het
Fam227a G A 15: 79,514,271 (GRCm39) S363L possibly damaging Het
Fam98b A G 2: 117,101,381 (GRCm39) R398G unknown Het
Gdnf G T 15: 7,864,134 (GRCm39) E182* probably null Het
Gys2 T C 6: 142,406,921 (GRCm39) H145R probably benign Het
Hcls1 A G 16: 36,767,003 (GRCm39) K69R probably benign Het
Itih5 A G 2: 10,239,869 (GRCm39) N332S probably benign Het
Kcnb2 T A 1: 15,382,934 (GRCm39) Y87N probably damaging Het
Lrriq3 A G 3: 154,893,873 (GRCm39) N525D probably damaging Het
Lsg1 A T 16: 30,380,569 (GRCm39) W623R probably damaging Het
Myo10 A G 15: 25,725,158 (GRCm39) Y243C probably benign Het
Nans T C 4: 46,492,814 (GRCm39) Y81H probably damaging Het
Nup54 T G 5: 92,573,605 (GRCm39) N199T probably benign Het
Or2h1 A G 17: 37,404,664 (GRCm39) L34P probably damaging Het
Or4c126 C T 2: 89,824,348 (GRCm39) L204F probably benign Het
Or4k15 T C 14: 50,364,604 (GRCm39) I190T probably benign Het
Or5w13 A T 2: 87,524,088 (GRCm39) I46N probably damaging Het
Or7d9 T A 9: 20,197,337 (GRCm39) L122* probably null Het
Pcnt G A 10: 76,256,039 (GRCm39) R734W probably damaging Het
Peg10 T C 6: 4,755,462 (GRCm39) F13L possibly damaging Het
Plcb1 T C 2: 135,091,972 (GRCm39) probably null Het
Ppfibp1 T C 6: 146,902,448 (GRCm39) V285A possibly damaging Het
Prpf39 T C 12: 65,102,036 (GRCm39) V371A possibly damaging Het
Psmb11 G A 14: 54,863,013 (GRCm39) C77Y probably damaging Het
Rrbp1 A G 2: 143,797,053 (GRCm39) L1133P probably benign Het
Slc16a1 G T 3: 104,560,149 (GRCm39) M151I probably benign Het
Tarm1 G T 7: 3,546,037 (GRCm39) Q89K possibly damaging Het
Tas2r116 T C 6: 132,832,540 (GRCm39) I47T probably damaging Het
Tmod3 T C 9: 75,436,680 (GRCm39) D85G probably damaging Het
Trbv14 T C 6: 41,112,299 (GRCm39) L32P probably benign Het
Trim16 T C 11: 62,741,414 (GRCm39) L486P probably benign Het
Trmt1l T G 1: 151,325,727 (GRCm39) S391A probably benign Het
Ush2a T A 1: 188,582,254 (GRCm39) N3772K probably damaging Het
Vmn1r230 G T 17: 21,066,870 (GRCm39) A20S probably benign Het
Wdr76 A G 2: 121,341,179 (GRCm39) N75D possibly damaging Het
Zfp977 A G 7: 42,230,102 (GRCm39) L141S probably benign Het
Zfp988 A G 4: 147,416,808 (GRCm39) D414G probably benign Het
Other mutations in Fsip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Fsip2 APN 2 82,820,730 (GRCm39) missense probably benign 0.18
IGL00557:Fsip2 APN 2 82,821,657 (GRCm39) missense possibly damaging 0.53
IGL01343:Fsip2 APN 2 82,830,163 (GRCm39) missense possibly damaging 0.53
IGL01387:Fsip2 APN 2 82,823,326 (GRCm39) missense possibly damaging 0.71
IGL01523:Fsip2 APN 2 82,807,863 (GRCm39) missense probably benign
IGL01554:Fsip2 APN 2 82,807,622 (GRCm39) missense possibly damaging 0.68
IGL01650:Fsip2 APN 2 82,821,430 (GRCm39) missense probably benign 0.33
IGL01809:Fsip2 APN 2 82,808,691 (GRCm39) missense possibly damaging 0.80
IGL01826:Fsip2 APN 2 82,812,983 (GRCm39) missense probably benign 0.18
IGL01830:Fsip2 APN 2 82,815,273 (GRCm39) missense probably benign
IGL01918:Fsip2 APN 2 82,822,482 (GRCm39) missense possibly damaging 0.71
IGL01932:Fsip2 APN 2 82,824,349 (GRCm39) missense possibly damaging 0.71
IGL01989:Fsip2 APN 2 82,824,211 (GRCm39) missense probably damaging 0.99
IGL02096:Fsip2 APN 2 82,822,204 (GRCm39) missense possibly damaging 0.85
IGL02153:Fsip2 APN 2 82,809,065 (GRCm39) missense probably benign
IGL02155:Fsip2 APN 2 82,828,696 (GRCm39) missense probably benign
IGL02219:Fsip2 APN 2 82,808,174 (GRCm39) missense probably benign 0.07
IGL02248:Fsip2 APN 2 82,813,116 (GRCm39) missense possibly damaging 0.73
IGL02316:Fsip2 APN 2 82,809,137 (GRCm39) missense probably benign
IGL02478:Fsip2 APN 2 82,814,736 (GRCm39) missense probably benign 0.00
IGL02504:Fsip2 APN 2 82,809,199 (GRCm39) missense possibly damaging 0.83
IGL02572:Fsip2 APN 2 82,822,347 (GRCm39) missense probably benign 0.32
IGL02625:Fsip2 APN 2 82,779,836 (GRCm39) missense probably benign 0.00
IGL02665:Fsip2 APN 2 82,823,407 (GRCm39) missense probably damaging 1.00
IGL02668:Fsip2 APN 2 82,828,662 (GRCm39) missense probably benign 0.06
IGL02676:Fsip2 APN 2 82,812,501 (GRCm39) missense possibly damaging 0.53
IGL02717:Fsip2 APN 2 82,781,370 (GRCm39) splice site probably benign
IGL02805:Fsip2 APN 2 82,823,839 (GRCm39) missense probably benign 0.01
IGL02943:Fsip2 APN 2 82,822,701 (GRCm39) missense probably benign 0.32
IGL02965:Fsip2 APN 2 82,813,398 (GRCm39) missense probably benign 0.33
IGL03001:Fsip2 APN 2 82,820,968 (GRCm39) intron probably benign
IGL03076:Fsip2 APN 2 82,812,482 (GRCm39) missense possibly damaging 0.96
IGL03229:Fsip2 APN 2 82,808,420 (GRCm39) missense possibly damaging 0.86
IGL03353:Fsip2 APN 2 82,807,737 (GRCm39) missense possibly damaging 0.85
IGL03401:Fsip2 APN 2 82,820,814 (GRCm39) missense probably benign
bubblegum UTSW 2 82,823,184 (GRCm39) missense probably benign 0.16
Dao UTSW 2 82,823,494 (GRCm39) missense probably damaging 0.97
engulf UTSW 2 82,815,120 (GRCm39) missense probably damaging 0.98
envelope UTSW 2 82,811,085 (GRCm39) missense probably benign 0.07
gladius UTSW 2 82,812,293 (GRCm39) missense possibly damaging 0.68
glove UTSW 2 82,808,738 (GRCm39) missense possibly damaging 0.85
Katana UTSW 2 82,819,860 (GRCm39) missense probably benign 0.07
scarf UTSW 2 82,817,235 (GRCm39) missense probably benign
Sock UTSW 2 82,828,524 (GRCm39) missense probably benign 0.00
swaddle UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
wrap UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
Wrapper UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
D4186:Fsip2 UTSW 2 82,818,756 (GRCm39) missense probably benign 0.32
FR4976:Fsip2 UTSW 2 82,814,709 (GRCm39) critical splice acceptor site probably benign
FR4976:Fsip2 UTSW 2 82,814,706 (GRCm39) critical splice acceptor site probably benign
PIT4382001:Fsip2 UTSW 2 82,821,196 (GRCm39) missense possibly damaging 0.86
R0017:Fsip2 UTSW 2 82,822,416 (GRCm39) missense probably damaging 0.98
R0017:Fsip2 UTSW 2 82,822,416 (GRCm39) missense probably damaging 0.98
R0021:Fsip2 UTSW 2 82,830,201 (GRCm39) splice site probably benign
R0054:Fsip2 UTSW 2 82,817,299 (GRCm39) missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82,817,299 (GRCm39) missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82,806,952 (GRCm39) missense probably damaging 0.96
R0104:Fsip2 UTSW 2 82,809,317 (GRCm39) missense possibly damaging 0.91
R0104:Fsip2 UTSW 2 82,809,317 (GRCm39) missense possibly damaging 0.91
R0127:Fsip2 UTSW 2 82,815,269 (GRCm39) missense probably benign 0.28
R0131:Fsip2 UTSW 2 82,821,465 (GRCm39) missense probably benign
R0149:Fsip2 UTSW 2 82,805,849 (GRCm39) missense possibly damaging 0.93
R0167:Fsip2 UTSW 2 82,811,151 (GRCm39) missense possibly damaging 0.53
R0190:Fsip2 UTSW 2 82,815,521 (GRCm39) missense possibly damaging 0.73
R0323:Fsip2 UTSW 2 82,816,240 (GRCm39) missense probably benign 0.33
R0358:Fsip2 UTSW 2 82,813,677 (GRCm39) missense possibly damaging 0.56
R0361:Fsip2 UTSW 2 82,805,849 (GRCm39) missense possibly damaging 0.93
R0369:Fsip2 UTSW 2 82,814,908 (GRCm39) missense probably benign 0.33
R0394:Fsip2 UTSW 2 82,821,419 (GRCm39) missense possibly damaging 0.70
R0532:Fsip2 UTSW 2 82,808,129 (GRCm39) missense probably benign 0.33
R0595:Fsip2 UTSW 2 82,777,296 (GRCm39) missense probably damaging 0.99
R0613:Fsip2 UTSW 2 82,824,139 (GRCm39) missense probably damaging 0.99
R0614:Fsip2 UTSW 2 82,807,877 (GRCm39) missense probably benign 0.15
R0619:Fsip2 UTSW 2 82,774,484 (GRCm39) missense probably damaging 1.00
R0626:Fsip2 UTSW 2 82,819,302 (GRCm39) missense probably benign 0.06
R0644:Fsip2 UTSW 2 82,807,241 (GRCm39) missense probably benign 0.02
R0661:Fsip2 UTSW 2 82,816,513 (GRCm39) missense possibly damaging 0.92
R0680:Fsip2 UTSW 2 82,821,703 (GRCm39) missense possibly damaging 0.73
R0688:Fsip2 UTSW 2 82,812,683 (GRCm39) missense probably benign 0.18
R0881:Fsip2 UTSW 2 82,816,617 (GRCm39) missense possibly damaging 0.52
R0919:Fsip2 UTSW 2 82,815,828 (GRCm39) missense possibly damaging 0.53
R0973:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0973:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0974:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0976:Fsip2 UTSW 2 82,828,375 (GRCm39) missense possibly damaging 0.92
R1025:Fsip2 UTSW 2 82,819,780 (GRCm39) nonsense probably null
R1026:Fsip2 UTSW 2 82,818,805 (GRCm39) missense possibly damaging 0.52
R1140:Fsip2 UTSW 2 82,805,378 (GRCm39) missense probably damaging 0.99
R1170:Fsip2 UTSW 2 82,821,844 (GRCm39) missense possibly damaging 0.72
R1180:Fsip2 UTSW 2 82,805,570 (GRCm39) missense probably damaging 0.99
R1188:Fsip2 UTSW 2 82,805,361 (GRCm39) missense possibly damaging 0.96
R1226:Fsip2 UTSW 2 82,811,355 (GRCm39) missense probably damaging 0.96
R1248:Fsip2 UTSW 2 82,820,107 (GRCm39) missense possibly damaging 0.93
R1273:Fsip2 UTSW 2 82,819,752 (GRCm39) missense possibly damaging 0.92
R1323:Fsip2 UTSW 2 82,816,096 (GRCm39) missense probably damaging 1.00
R1323:Fsip2 UTSW 2 82,816,096 (GRCm39) missense probably damaging 1.00
R1356:Fsip2 UTSW 2 82,820,089 (GRCm39) missense probably benign 0.38
R1413:Fsip2 UTSW 2 82,818,762 (GRCm39) missense possibly damaging 0.93
R1430:Fsip2 UTSW 2 82,828,407 (GRCm39) missense possibly damaging 0.71
R1475:Fsip2 UTSW 2 82,817,539 (GRCm39) missense probably damaging 0.99
R1489:Fsip2 UTSW 2 82,810,155 (GRCm39) missense probably benign
R1520:Fsip2 UTSW 2 82,811,058 (GRCm39) missense possibly damaging 0.96
R1543:Fsip2 UTSW 2 82,811,931 (GRCm39) missense possibly damaging 0.91
R1581:Fsip2 UTSW 2 82,816,626 (GRCm39) missense probably damaging 0.98
R1590:Fsip2 UTSW 2 82,813,131 (GRCm39) missense probably benign 0.26
R1646:Fsip2 UTSW 2 82,808,861 (GRCm39) missense probably benign 0.07
R1678:Fsip2 UTSW 2 82,816,689 (GRCm39) missense probably benign
R1700:Fsip2 UTSW 2 82,822,081 (GRCm39) missense probably benign 0.33
R1717:Fsip2 UTSW 2 82,805,289 (GRCm39) missense possibly damaging 0.68
R1741:Fsip2 UTSW 2 82,820,256 (GRCm39) missense probably benign 0.32
R1760:Fsip2 UTSW 2 82,818,055 (GRCm39) missense possibly damaging 0.71
R1760:Fsip2 UTSW 2 82,815,240 (GRCm39) missense probably benign 0.07
R1760:Fsip2 UTSW 2 82,830,185 (GRCm39) missense possibly damaging 0.85
R1789:Fsip2 UTSW 2 82,807,906 (GRCm39) missense probably benign 0.00
R1850:Fsip2 UTSW 2 82,814,933 (GRCm39) missense possibly damaging 0.72
R1854:Fsip2 UTSW 2 82,823,601 (GRCm39) missense possibly damaging 0.84
R1888:Fsip2 UTSW 2 82,774,504 (GRCm39) missense probably benign 0.04
R1888:Fsip2 UTSW 2 82,774,504 (GRCm39) missense probably benign 0.04
R1905:Fsip2 UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
R1907:Fsip2 UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
R1920:Fsip2 UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
R1921:Fsip2 UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
R1921:Fsip2 UTSW 2 82,811,127 (GRCm39) nonsense probably null
R1931:Fsip2 UTSW 2 82,817,077 (GRCm39) missense probably damaging 0.99
R1934:Fsip2 UTSW 2 82,810,902 (GRCm39) missense possibly damaging 0.91
R1959:Fsip2 UTSW 2 82,821,894 (GRCm39) missense probably benign
R1965:Fsip2 UTSW 2 82,823,124 (GRCm39) missense possibly damaging 0.86
R1966:Fsip2 UTSW 2 82,823,124 (GRCm39) missense possibly damaging 0.86
R1983:Fsip2 UTSW 2 82,810,175 (GRCm39) missense probably benign
R1988:Fsip2 UTSW 2 82,806,861 (GRCm39) missense possibly damaging 0.56
R2016:Fsip2 UTSW 2 82,813,076 (GRCm39) missense possibly damaging 0.53
R2017:Fsip2 UTSW 2 82,813,076 (GRCm39) missense possibly damaging 0.53
R2026:Fsip2 UTSW 2 82,819,788 (GRCm39) missense possibly damaging 0.71
R2034:Fsip2 UTSW 2 82,819,838 (GRCm39) missense probably benign 0.43
R2037:Fsip2 UTSW 2 82,808,856 (GRCm39) missense probably damaging 0.99
R2070:Fsip2 UTSW 2 82,806,699 (GRCm39) missense probably damaging 0.98
R2072:Fsip2 UTSW 2 82,839,159 (GRCm39) missense possibly damaging 0.53
R2075:Fsip2 UTSW 2 82,818,923 (GRCm39) missense possibly damaging 0.85
R2143:Fsip2 UTSW 2 82,820,615 (GRCm39) missense possibly damaging 0.93
R2207:Fsip2 UTSW 2 82,807,823 (GRCm39) missense probably benign 0.02
R2256:Fsip2 UTSW 2 82,793,095 (GRCm39) missense probably benign 0.07
R2315:Fsip2 UTSW 2 82,805,437 (GRCm39) missense probably benign
R2344:Fsip2 UTSW 2 82,820,257 (GRCm39) missense possibly damaging 0.71
R2377:Fsip2 UTSW 2 82,806,593 (GRCm39) missense probably benign 0.29
R2403:Fsip2 UTSW 2 82,811,064 (GRCm39) missense possibly damaging 0.53
R2441:Fsip2 UTSW 2 82,815,685 (GRCm39) missense possibly damaging 0.53
R2504:Fsip2 UTSW 2 82,809,954 (GRCm39) missense possibly damaging 0.86
R2510:Fsip2 UTSW 2 82,816,782 (GRCm39) missense probably benign
R2511:Fsip2 UTSW 2 82,816,782 (GRCm39) missense probably benign
R2511:Fsip2 UTSW 2 82,782,001 (GRCm39) missense probably damaging 1.00
R2512:Fsip2 UTSW 2 82,808,511 (GRCm39) missense probably benign 0.04
R2568:Fsip2 UTSW 2 82,820,775 (GRCm39) missense probably benign 0.14
R2656:Fsip2 UTSW 2 82,809,389 (GRCm39) missense possibly damaging 0.83
R2883:Fsip2 UTSW 2 82,821,868 (GRCm39) missense possibly damaging 0.86
R3417:Fsip2 UTSW 2 82,816,854 (GRCm39) missense possibly damaging 0.51
R3431:Fsip2 UTSW 2 82,822,354 (GRCm39) missense possibly damaging 0.85
R3441:Fsip2 UTSW 2 82,817,071 (GRCm39) missense probably benign 0.00
R3605:Fsip2 UTSW 2 82,815,253 (GRCm39) missense probably benign 0.28
R3620:Fsip2 UTSW 2 82,810,602 (GRCm39) missense probably benign 0.00
R3621:Fsip2 UTSW 2 82,810,602 (GRCm39) missense probably benign 0.00
R3726:Fsip2 UTSW 2 82,819,311 (GRCm39) missense possibly damaging 0.84
R3755:Fsip2 UTSW 2 82,808,561 (GRCm39) missense probably benign 0.26
R3789:Fsip2 UTSW 2 82,813,058 (GRCm39) missense probably damaging 0.96
R3836:Fsip2 UTSW 2 82,781,290 (GRCm39) missense probably damaging 1.00
R3844:Fsip2 UTSW 2 82,819,950 (GRCm39) missense possibly damaging 0.52
R3846:Fsip2 UTSW 2 82,816,759 (GRCm39) missense possibly damaging 0.52
R3861:Fsip2 UTSW 2 82,815,120 (GRCm39) missense probably damaging 0.98
R3981:Fsip2 UTSW 2 82,789,006 (GRCm39) missense probably benign 0.08
R4014:Fsip2 UTSW 2 82,813,862 (GRCm39) missense probably benign
R4042:Fsip2 UTSW 2 82,813,896 (GRCm39) missense probably benign 0.02
R4075:Fsip2 UTSW 2 82,813,245 (GRCm39) missense probably benign 0.26
R4154:Fsip2 UTSW 2 82,817,413 (GRCm39) missense possibly damaging 0.71
R4210:Fsip2 UTSW 2 82,805,493 (GRCm39) missense probably damaging 0.99
R4211:Fsip2 UTSW 2 82,805,493 (GRCm39) missense probably damaging 0.99
R4327:Fsip2 UTSW 2 82,817,403 (GRCm39) missense probably benign 0.25
R4332:Fsip2 UTSW 2 82,808,201 (GRCm39) missense probably benign 0.00
R4440:Fsip2 UTSW 2 82,821,550 (GRCm39) missense possibly damaging 0.85
R4454:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4455:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4457:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4458:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4540:Fsip2 UTSW 2 82,782,009 (GRCm39) missense probably benign
R4549:Fsip2 UTSW 2 82,819,972 (GRCm39) missense probably damaging 0.99
R4558:Fsip2 UTSW 2 82,815,297 (GRCm39) missense possibly damaging 0.73
R4573:Fsip2 UTSW 2 82,816,510 (GRCm39) missense possibly damaging 0.71
R4583:Fsip2 UTSW 2 82,809,017 (GRCm39) missense probably benign 0.33
R4618:Fsip2 UTSW 2 82,818,103 (GRCm39) missense probably benign
R4700:Fsip2 UTSW 2 82,817,373 (GRCm39) missense probably benign 0.32
R4716:Fsip2 UTSW 2 82,805,203 (GRCm39) missense probably damaging 0.96
R4739:Fsip2 UTSW 2 82,805,697 (GRCm39) missense possibly damaging 0.92
R4749:Fsip2 UTSW 2 82,819,629 (GRCm39) missense probably benign 0.06
R4791:Fsip2 UTSW 2 82,812,452 (GRCm39) missense possibly damaging 0.53
R4793:Fsip2 UTSW 2 82,818,044 (GRCm39) nonsense probably null
R4819:Fsip2 UTSW 2 82,818,786 (GRCm39) missense probably benign 0.06
R4832:Fsip2 UTSW 2 82,820,515 (GRCm39) missense possibly damaging 0.92
R4840:Fsip2 UTSW 2 82,815,815 (GRCm39) missense probably benign 0.26
R4840:Fsip2 UTSW 2 82,779,739 (GRCm39) missense probably benign 0.01
R4865:Fsip2 UTSW 2 82,821,295 (GRCm39) missense possibly damaging 0.86
R4876:Fsip2 UTSW 2 82,805,202 (GRCm39) missense possibly damaging 0.91
R4885:Fsip2 UTSW 2 82,818,438 (GRCm39) missense probably benign 0.02
R4911:Fsip2 UTSW 2 82,811,837 (GRCm39) missense possibly damaging 0.85
R4918:Fsip2 UTSW 2 82,824,114 (GRCm39) missense possibly damaging 0.51
R4936:Fsip2 UTSW 2 82,815,384 (GRCm39) missense probably benign 0.18
R4950:Fsip2 UTSW 2 82,807,758 (GRCm39) missense probably benign 0.03
R4950:Fsip2 UTSW 2 82,777,276 (GRCm39) missense probably damaging 0.97
R4959:Fsip2 UTSW 2 82,815,169 (GRCm39) missense probably benign 0.00
R4971:Fsip2 UTSW 2 82,816,222 (GRCm39) missense probably benign 0.38
R4973:Fsip2 UTSW 2 82,815,169 (GRCm39) missense probably benign 0.00
R4976:Fsip2 UTSW 2 82,818,535 (GRCm39) missense probably damaging 0.99
R5022:Fsip2 UTSW 2 82,809,773 (GRCm39) missense probably benign 0.33
R5027:Fsip2 UTSW 2 82,819,477 (GRCm39) missense possibly damaging 0.71
R5030:Fsip2 UTSW 2 82,818,836 (GRCm39) missense possibly damaging 0.85
R5048:Fsip2 UTSW 2 82,823,494 (GRCm39) missense probably damaging 0.97
R5096:Fsip2 UTSW 2 82,821,460 (GRCm39) missense probably benign 0.00
R5097:Fsip2 UTSW 2 82,822,329 (GRCm39) missense probably benign
R5119:Fsip2 UTSW 2 82,818,535 (GRCm39) missense probably damaging 0.99
R5138:Fsip2 UTSW 2 82,811,768 (GRCm39) missense probably benign 0.12
R5152:Fsip2 UTSW 2 82,808,916 (GRCm39) missense probably benign 0.43
R5174:Fsip2 UTSW 2 82,811,085 (GRCm39) missense probably benign 0.07
R5193:Fsip2 UTSW 2 82,813,338 (GRCm39) missense possibly damaging 0.53
R5245:Fsip2 UTSW 2 82,823,505 (GRCm39) missense probably benign 0.02
R5282:Fsip2 UTSW 2 82,808,925 (GRCm39) missense possibly damaging 0.61
R5323:Fsip2 UTSW 2 82,818,489 (GRCm39) missense possibly damaging 0.71
R5326:Fsip2 UTSW 2 82,812,207 (GRCm39) missense possibly damaging 0.84
R5378:Fsip2 UTSW 2 82,820,185 (GRCm39) missense possibly damaging 0.71
R5380:Fsip2 UTSW 2 82,805,742 (GRCm39) missense possibly damaging 0.91
R5396:Fsip2 UTSW 2 82,821,262 (GRCm39) missense probably benign 0.00
R5422:Fsip2 UTSW 2 82,812,572 (GRCm39) missense probably benign 0.00
R5481:Fsip2 UTSW 2 82,810,230 (GRCm39) missense probably benign 0.26
R5482:Fsip2 UTSW 2 82,815,654 (GRCm39) missense possibly damaging 0.80
R5513:Fsip2 UTSW 2 82,815,542 (GRCm39) missense possibly damaging 0.72
R5513:Fsip2 UTSW 2 82,781,256 (GRCm39) missense probably benign 0.07
R5513:Fsip2 UTSW 2 82,781,252 (GRCm39) missense probably damaging 1.00
R5536:Fsip2 UTSW 2 82,817,403 (GRCm39) missense probably benign 0.25
R5542:Fsip2 UTSW 2 82,812,207 (GRCm39) missense possibly damaging 0.84
R5553:Fsip2 UTSW 2 82,793,090 (GRCm39) missense probably benign
R5568:Fsip2 UTSW 2 82,816,908 (GRCm39) missense probably benign 0.25
R5581:Fsip2 UTSW 2 82,828,472 (GRCm39) missense possibly damaging 0.84
R5664:Fsip2 UTSW 2 82,818,439 (GRCm39) missense probably benign 0.05
R5672:Fsip2 UTSW 2 82,817,838 (GRCm39) nonsense probably null
R5712:Fsip2 UTSW 2 82,839,192 (GRCm39) missense possibly damaging 0.73
R5762:Fsip2 UTSW 2 82,808,260 (GRCm39) missense probably benign 0.33
R5772:Fsip2 UTSW 2 82,815,084 (GRCm39) missense probably benign
R5881:Fsip2 UTSW 2 82,814,785 (GRCm39) missense possibly damaging 0.72
R5919:Fsip2 UTSW 2 82,822,953 (GRCm39) missense possibly damaging 0.71
R5920:Fsip2 UTSW 2 82,818,852 (GRCm39) nonsense probably null
R5934:Fsip2 UTSW 2 82,817,092 (GRCm39) missense possibly damaging 0.86
R5938:Fsip2 UTSW 2 82,807,835 (GRCm39) missense probably benign 0.00
R5974:Fsip2 UTSW 2 82,793,657 (GRCm39) missense possibly damaging 0.68
R5991:Fsip2 UTSW 2 82,820,812 (GRCm39) missense probably benign 0.28
R6019:Fsip2 UTSW 2 82,818,283 (GRCm39) missense possibly damaging 0.52
R6020:Fsip2 UTSW 2 82,822,471 (GRCm39) missense probably damaging 0.99
R6056:Fsip2 UTSW 2 82,816,017 (GRCm39) missense probably benign 0.01
R6057:Fsip2 UTSW 2 82,809,777 (GRCm39) missense probably damaging 0.99
R6139:Fsip2 UTSW 2 82,821,388 (GRCm39) missense possibly damaging 0.85
R6145:Fsip2 UTSW 2 82,824,112 (GRCm39) missense possibly damaging 0.71
R6160:Fsip2 UTSW 2 82,818,289 (GRCm39) nonsense probably null
R6161:Fsip2 UTSW 2 82,817,601 (GRCm39) missense possibly damaging 0.80
R6166:Fsip2 UTSW 2 82,811,071 (GRCm39) missense probably benign 0.00
R6187:Fsip2 UTSW 2 82,812,798 (GRCm39) missense probably benign 0.33
R6196:Fsip2 UTSW 2 82,820,227 (GRCm39) missense possibly damaging 0.71
R6217:Fsip2 UTSW 2 82,818,762 (GRCm39) missense possibly damaging 0.93
R6276:Fsip2 UTSW 2 82,810,785 (GRCm39) missense possibly damaging 0.91
R6278:Fsip2 UTSW 2 82,819,242 (GRCm39) missense probably benign 0.16
R6349:Fsip2 UTSW 2 82,823,416 (GRCm39) missense probably benign 0.05
R6351:Fsip2 UTSW 2 82,823,028 (GRCm39) missense possibly damaging 0.51
R6401:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6404:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6405:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6437:Fsip2 UTSW 2 82,813,836 (GRCm39) missense possibly damaging 0.73
R6478:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6479:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6480:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6481:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6521:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6529:Fsip2 UTSW 2 82,812,657 (GRCm39) missense probably benign
R6621:Fsip2 UTSW 2 82,820,158 (GRCm39) missense possibly damaging 0.93
R6639:Fsip2 UTSW 2 82,813,571 (GRCm39) missense possibly damaging 0.85
R6649:Fsip2 UTSW 2 82,798,161 (GRCm39) missense possibly damaging 0.83
R6714:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6714:Fsip2 UTSW 2 82,809,878 (GRCm39) missense probably benign 0.01
R6749:Fsip2 UTSW 2 82,808,738 (GRCm39) missense possibly damaging 0.85
R6765:Fsip2 UTSW 2 82,816,776 (GRCm39) missense probably benign
R6790:Fsip2 UTSW 2 82,821,283 (GRCm39) missense possibly damaging 0.53
R6793:Fsip2 UTSW 2 82,819,838 (GRCm39) missense probably benign 0.43
R6795:Fsip2 UTSW 2 82,811,303 (GRCm39) missense probably benign 0.08
R6818:Fsip2 UTSW 2 82,815,544 (GRCm39) missense probably benign 0.04
R6844:Fsip2 UTSW 2 82,813,969 (GRCm39) missense possibly damaging 0.72
R6848:Fsip2 UTSW 2 82,813,131 (GRCm39) missense probably benign 0.26
R6945:Fsip2 UTSW 2 82,823,184 (GRCm39) missense probably benign 0.16
R6950:Fsip2 UTSW 2 82,816,332 (GRCm39) missense probably benign 0.03
R6951:Fsip2 UTSW 2 82,812,293 (GRCm39) missense possibly damaging 0.68
R6974:Fsip2 UTSW 2 82,809,061 (GRCm39) missense probably damaging 0.96
R6987:Fsip2 UTSW 2 82,778,630 (GRCm39) nonsense probably null
R6989:Fsip2 UTSW 2 82,807,298 (GRCm39) missense probably benign 0.00
R7001:Fsip2 UTSW 2 82,817,269 (GRCm39) missense probably damaging 1.00
R7002:Fsip2 UTSW 2 82,819,687 (GRCm39) missense possibly damaging 0.86
R7016:Fsip2 UTSW 2 82,820,979 (GRCm39) missense probably benign 0.25
R7066:Fsip2 UTSW 2 82,821,235 (GRCm39) missense possibly damaging 0.86
R7067:Fsip2 UTSW 2 82,811,078 (GRCm39) missense possibly damaging 0.85
R7077:Fsip2 UTSW 2 82,813,496 (GRCm39) missense probably benign 0.18
R7099:Fsip2 UTSW 2 82,817,968 (GRCm39) missense probably benign
R7126:Fsip2 UTSW 2 82,813,485 (GRCm39) missense possibly damaging 0.53
R7156:Fsip2 UTSW 2 82,813,085 (GRCm39) missense probably benign 0.00
R7165:Fsip2 UTSW 2 82,811,541 (GRCm39) missense possibly damaging 0.77
R7171:Fsip2 UTSW 2 82,816,571 (GRCm39) nonsense probably null
R7189:Fsip2 UTSW 2 82,823,581 (GRCm39) missense possibly damaging 0.92
R7217:Fsip2 UTSW 2 82,819,412 (GRCm39) missense possibly damaging 0.85
R7222:Fsip2 UTSW 2 82,814,015 (GRCm39) missense probably benign
R7228:Fsip2 UTSW 2 82,822,651 (GRCm39) missense possibly damaging 0.93
R7238:Fsip2 UTSW 2 82,812,484 (GRCm39) missense possibly damaging 0.72
R7244:Fsip2 UTSW 2 82,823,607 (GRCm39) missense possibly damaging 0.92
R7251:Fsip2 UTSW 2 82,809,425 (GRCm39) missense possibly damaging 0.95
R7259:Fsip2 UTSW 2 82,812,474 (GRCm39) missense possibly damaging 0.85
R7291:Fsip2 UTSW 2 82,810,863 (GRCm39) missense possibly damaging 0.91
R7316:Fsip2 UTSW 2 82,820,035 (GRCm39) missense possibly damaging 0.93
R7323:Fsip2 UTSW 2 82,819,860 (GRCm39) missense probably benign 0.07
R7335:Fsip2 UTSW 2 82,813,462 (GRCm39) missense probably benign
R7343:Fsip2 UTSW 2 82,809,711 (GRCm39) missense probably benign 0.07
R7346:Fsip2 UTSW 2 82,828,524 (GRCm39) missense probably benign 0.00
R7389:Fsip2 UTSW 2 82,819,140 (GRCm39) missense possibly damaging 0.51
R7391:Fsip2 UTSW 2 82,820,663 (GRCm39) missense possibly damaging 0.70
R7397:Fsip2 UTSW 2 82,815,601 (GRCm39) missense possibly damaging 0.53
R7426:Fsip2 UTSW 2 82,810,441 (GRCm39) missense probably damaging 0.98
R7450:Fsip2 UTSW 2 82,782,024 (GRCm39) missense probably benign 0.30
R7538:Fsip2 UTSW 2 82,818,894 (GRCm39) missense possibly damaging 0.86
R7542:Fsip2 UTSW 2 82,815,196 (GRCm39) missense possibly damaging 0.96
R7549:Fsip2 UTSW 2 82,824,337 (GRCm39) missense probably damaging 0.99
R7564:Fsip2 UTSW 2 82,819,361 (GRCm39) missense probably benign 0.02
R7565:Fsip2 UTSW 2 82,779,856 (GRCm39) missense probably damaging 0.97
R7583:Fsip2 UTSW 2 82,805,585 (GRCm39) missense probably benign 0.12
R7641:Fsip2 UTSW 2 82,817,256 (GRCm39) nonsense probably null
R7655:Fsip2 UTSW 2 82,807,886 (GRCm39) missense possibly damaging 0.91
R7656:Fsip2 UTSW 2 82,807,886 (GRCm39) missense possibly damaging 0.91
R7665:Fsip2 UTSW 2 82,812,149 (GRCm39) missense probably benign 0.03
R7672:Fsip2 UTSW 2 82,820,455 (GRCm39) missense possibly damaging 0.93
R7764:Fsip2 UTSW 2 82,811,252 (GRCm39) missense possibly damaging 0.93
R7790:Fsip2 UTSW 2 82,818,723 (GRCm39) missense probably benign
R7811:Fsip2 UTSW 2 82,828,797 (GRCm39) missense possibly damaging 0.93
R7838:Fsip2 UTSW 2 82,807,044 (GRCm39) missense probably benign 0.00
R7873:Fsip2 UTSW 2 82,779,856 (GRCm39) missense probably damaging 0.97
R7902:Fsip2 UTSW 2 82,808,168 (GRCm39) missense possibly damaging 0.72
R7920:Fsip2 UTSW 2 82,781,365 (GRCm39) missense possibly damaging 0.94
R7959:Fsip2 UTSW 2 82,816,120 (GRCm39) missense possibly damaging 0.51
R8009:Fsip2 UTSW 2 82,818,793 (GRCm39) missense possibly damaging 0.85
R8031:Fsip2 UTSW 2 82,817,235 (GRCm39) missense probably benign
R8034:Fsip2 UTSW 2 82,819,699 (GRCm39) missense possibly damaging 0.92
R8037:Fsip2 UTSW 2 82,816,322 (GRCm39) missense possibly damaging 0.72
R8110:Fsip2 UTSW 2 82,789,017 (GRCm39) missense probably benign 0.00
R8117:Fsip2 UTSW 2 82,823,296 (GRCm39) missense possibly damaging 0.86
R8138:Fsip2 UTSW 2 82,806,141 (GRCm39) missense possibly damaging 0.83
R8175:Fsip2 UTSW 2 82,818,021 (GRCm39) missense probably benign 0.16
R8175:Fsip2 UTSW 2 82,815,088 (GRCm39) missense probably benign 0.06
R8182:Fsip2 UTSW 2 82,806,951 (GRCm39) missense probably damaging 0.99
R8206:Fsip2 UTSW 2 82,820,808 (GRCm39) missense possibly damaging 0.85
R8229:Fsip2 UTSW 2 82,808,487 (GRCm39) missense possibly damaging 0.63
R8239:Fsip2 UTSW 2 82,819,687 (GRCm39) missense possibly damaging 0.71
R8245:Fsip2 UTSW 2 82,811,346 (GRCm39) missense possibly damaging 0.79
R8303:Fsip2 UTSW 2 82,818,724 (GRCm39) missense probably benign 0.00
R8336:Fsip2 UTSW 2 82,821,099 (GRCm39) missense possibly damaging 0.53
R8347:Fsip2 UTSW 2 82,818,198 (GRCm39) missense probably benign 0.16
R8351:Fsip2 UTSW 2 82,822,239 (GRCm39) missense possibly damaging 0.73
R8352:Fsip2 UTSW 2 82,814,937 (GRCm39) missense probably benign
R8419:Fsip2 UTSW 2 82,808,963 (GRCm39) missense probably damaging 0.96
R8431:Fsip2 UTSW 2 82,811,910 (GRCm39) missense probably damaging 1.00
R8452:Fsip2 UTSW 2 82,814,937 (GRCm39) missense probably benign
R8459:Fsip2 UTSW 2 82,810,022 (GRCm39) missense possibly damaging 0.95
R8465:Fsip2 UTSW 2 82,810,284 (GRCm39) missense probably benign 0.26
R8473:Fsip2 UTSW 2 82,777,336 (GRCm39) missense probably damaging 0.99
R8703:Fsip2 UTSW 2 82,821,871 (GRCm39) missense probably damaging 0.98
R8711:Fsip2 UTSW 2 82,815,246 (GRCm39) missense possibly damaging 0.53
R8713:Fsip2 UTSW 2 82,811,453 (GRCm39) missense probably damaging 1.00
R8789:Fsip2 UTSW 2 82,815,822 (GRCm39) missense possibly damaging 0.73
R8805:Fsip2 UTSW 2 82,813,453 (GRCm39) missense possibly damaging 0.46
R8840:Fsip2 UTSW 2 82,821,606 (GRCm39) missense probably benign 0.03
R8855:Fsip2 UTSW 2 82,810,521 (GRCm39) missense probably benign 0.04
R8866:Fsip2 UTSW 2 82,810,521 (GRCm39) missense probably benign 0.04
R8875:Fsip2 UTSW 2 82,820,782 (GRCm39) missense possibly damaging 0.95
R8883:Fsip2 UTSW 2 82,809,524 (GRCm39) missense possibly damaging 0.68
R8903:Fsip2 UTSW 2 82,807,681 (GRCm39) missense possibly damaging 0.83
R8907:Fsip2 UTSW 2 82,816,984 (GRCm39) missense probably benign 0.20
R8912:Fsip2 UTSW 2 82,810,938 (GRCm39) missense probably benign
R8926:Fsip2 UTSW 2 82,823,927 (GRCm39) missense possibly damaging 0.84
R8991:Fsip2 UTSW 2 82,815,370 (GRCm39) missense probably benign 0.33
R9014:Fsip2 UTSW 2 82,806,898 (GRCm39) missense probably benign 0.32
R9014:Fsip2 UTSW 2 82,817,075 (GRCm39) missense possibly damaging 0.71
R9039:Fsip2 UTSW 2 82,828,545 (GRCm39) missense probably benign 0.32
R9054:Fsip2 UTSW 2 82,806,180 (GRCm39) missense possibly damaging 0.68
R9114:Fsip2 UTSW 2 82,807,301 (GRCm39) missense probably benign 0.00
R9124:Fsip2 UTSW 2 82,816,103 (GRCm39) missense probably benign 0.00
R9131:Fsip2 UTSW 2 82,813,170 (GRCm39) missense probably benign
R9149:Fsip2 UTSW 2 82,812,374 (GRCm39) missense possibly damaging 0.86
R9180:Fsip2 UTSW 2 82,815,574 (GRCm39) missense possibly damaging 0.96
R9192:Fsip2 UTSW 2 82,817,844 (GRCm39) missense probably benign 0.06
R9216:Fsip2 UTSW 2 82,820,425 (GRCm39) missense probably damaging 0.99
R9218:Fsip2 UTSW 2 82,823,062 (GRCm39) missense probably damaging 0.97
R9222:Fsip2 UTSW 2 82,815,958 (GRCm39) missense probably benign 0.00
R9262:Fsip2 UTSW 2 82,807,662 (GRCm39) missense probably benign 0.00
R9340:Fsip2 UTSW 2 82,818,604 (GRCm39) missense possibly damaging 0.71
R9342:Fsip2 UTSW 2 82,818,747 (GRCm39) missense possibly damaging 0.71
R9368:Fsip2 UTSW 2 82,811,039 (GRCm39) missense possibly damaging 0.68
R9372:Fsip2 UTSW 2 82,822,756 (GRCm39) missense possibly damaging 0.71
R9385:Fsip2 UTSW 2 82,819,793 (GRCm39) missense possibly damaging 0.84
R9432:Fsip2 UTSW 2 82,805,907 (GRCm39) missense probably damaging 0.98
R9434:Fsip2 UTSW 2 82,816,702 (GRCm39) missense possibly damaging 0.71
R9445:Fsip2 UTSW 2 82,806,132 (GRCm39) missense probably damaging 0.99
R9472:Fsip2 UTSW 2 82,817,285 (GRCm39) missense possibly damaging 0.85
R9496:Fsip2 UTSW 2 82,793,062 (GRCm39) missense probably benign
R9523:Fsip2 UTSW 2 82,807,972 (GRCm39) missense probably damaging 0.99
R9567:Fsip2 UTSW 2 82,798,173 (GRCm39) missense probably benign
R9636:Fsip2 UTSW 2 82,820,563 (GRCm39) missense possibly damaging 0.52
R9643:Fsip2 UTSW 2 82,821,984 (GRCm39) missense possibly damaging 0.53
R9680:Fsip2 UTSW 2 82,819,272 (GRCm39) missense probably benign 0.32
R9695:Fsip2 UTSW 2 82,806,226 (GRCm39) missense probably benign
R9705:Fsip2 UTSW 2 82,823,634 (GRCm39) missense probably benign
R9739:Fsip2 UTSW 2 82,823,896 (GRCm39) missense possibly damaging 0.71
R9751:Fsip2 UTSW 2 82,818,241 (GRCm39) missense probably benign 0.00
R9761:Fsip2 UTSW 2 82,821,994 (GRCm39) missense probably benign 0.00
R9798:Fsip2 UTSW 2 82,810,225 (GRCm39) nonsense probably null
RF003:Fsip2 UTSW 2 82,821,865 (GRCm39) missense probably benign 0.02
RF005:Fsip2 UTSW 2 82,822,876 (GRCm39) missense probably benign 0.04
RF008:Fsip2 UTSW 2 82,808,184 (GRCm39) missense probably benign
RF028:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF029:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF036:Fsip2 UTSW 2 82,814,707 (GRCm39) critical splice acceptor site probably benign
RF038:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF062:Fsip2 UTSW 2 82,814,707 (GRCm39) critical splice acceptor site probably benign
X0018:Fsip2 UTSW 2 82,812,851 (GRCm39) nonsense probably null
X0020:Fsip2 UTSW 2 82,781,364 (GRCm39) missense probably damaging 1.00
X0025:Fsip2 UTSW 2 82,785,290 (GRCm39) missense possibly damaging 0.70
X0027:Fsip2 UTSW 2 82,807,122 (GRCm39) missense probably benign 0.35
X0066:Fsip2 UTSW 2 82,817,807 (GRCm39) missense possibly damaging 0.51
Z1088:Fsip2 UTSW 2 82,818,978 (GRCm39) missense possibly damaging 0.85
Z1088:Fsip2 UTSW 2 82,817,997 (GRCm39) missense possibly damaging 0.86
Z1088:Fsip2 UTSW 2 82,805,792 (GRCm39) missense probably damaging 0.96
Z1176:Fsip2 UTSW 2 82,820,009 (GRCm39) missense probably benign 0.02
Z1177:Fsip2 UTSW 2 82,814,868 (GRCm39) missense probably damaging 0.98
Z1177:Fsip2 UTSW 2 82,777,304 (GRCm39) missense probably damaging 0.99
Z1177:Fsip2 UTSW 2 82,817,547 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CAGTTCATCCCACTCATGTAGC -3'
(R):5'- GGATCAGTGAACCACCCTTTG -3'

Sequencing Primer
(F):5'- ACTCATGTAGCTCCTTTTGATACTG -3'
(R):5'- AGTGAACCACCCTTTGTTTTTATGG -3'
Posted On 2020-10-20