Incidental Mutation 'R8439:Dock7'
ID654150
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Namededicator of cytokinesis 7
Synonyms3110056M06Rik, m, LOC242555
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8439 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location98936671-99120915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 99083029 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 100 (V100F)
Ref Sequence ENSEMBL: ENSMUSP00000117797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
Predicted Effect probably benign
Transcript: ENSMUST00000030286
AA Change: V100F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: V100F

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: V100F

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: V100F

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205650
AA Change: V100F

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,770,701 L482S probably damaging Het
Abca7 A T 10: 80,006,161 T1043S probably benign Het
Acadvl T A 11: 70,011,728 K410* probably null Het
Adam8 C T 7: 139,987,849 G354D probably benign Het
Ahctf1 T C 1: 179,762,610 E1366G possibly damaging Het
Bahcc1 C A 11: 120,274,589 Q949K probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Ccdc141 T A 2: 77,059,550 Y466F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cyp4a30b C A 4: 115,457,775 Q185K probably benign Het
Dlx2 A T 2: 71,545,538 I147K possibly damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dspp C A 5: 104,177,296 D508E unknown Het
Duox2 G T 2: 122,298,155 T4K probably benign Het
Ear1 T C 14: 43,819,247 N55D probably damaging Het
Echdc1 G C 10: 29,334,246 E179Q probably damaging Het
Ehbp1 T C 11: 22,096,109 M547V possibly damaging Het
Erbb2 A G 11: 98,428,972 N630S possibly damaging Het
Fam227a G A 15: 79,630,070 S363L possibly damaging Het
Fam98b A G 2: 117,270,900 R398G unknown Het
Fsip2 G A 2: 82,977,086 D1250N probably benign Het
Gdnf G T 15: 7,834,653 E182* probably null Het
Gys2 T C 6: 142,461,195 H145R probably benign Het
Hcls1 A G 16: 36,946,641 K69R probably benign Het
Itih5 A G 2: 10,235,058 N332S probably benign Het
Kcnb2 T A 1: 15,312,710 Y87N probably damaging Het
Lrriq3 A G 3: 155,188,236 N525D probably damaging Het
Lsg1 A T 16: 30,561,751 W623R probably damaging Het
Myo10 A G 15: 25,725,072 Y243C probably benign Het
Nans T C 4: 46,492,814 Y81H probably damaging Het
Nup54 T G 5: 92,425,746 N199T probably benign Het
Olfr1136 A T 2: 87,693,744 I46N probably damaging Het
Olfr1261 C T 2: 89,994,004 L204F probably benign Het
Olfr39 T A 9: 20,286,041 L122* probably null Het
Olfr727 T C 14: 50,127,147 I190T probably benign Het
Olfr91 A G 17: 37,093,772 L34P probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Peg10 T C 6: 4,755,462 F13L possibly damaging Het
Pih1d3 T A 1: 31,223,268 D110E probably damaging Het
Plcb1 T C 2: 135,250,052 probably null Het
Ppfibp1 T C 6: 147,000,950 V285A possibly damaging Het
Prpf39 T C 12: 65,055,262 V371A possibly damaging Het
Psmb11 G A 14: 54,625,556 C77Y probably damaging Het
Rrbp1 A G 2: 143,955,133 L1133P probably benign Het
Slc16a1 G T 3: 104,652,833 M151I probably benign Het
Tarm1 G T 7: 3,497,521 Q89K possibly damaging Het
Tas2r116 T C 6: 132,855,577 I47T probably damaging Het
Tmod3 T C 9: 75,529,398 D85G probably damaging Het
Trbv14 T C 6: 41,135,365 L32P probably benign Het
Trim16 T C 11: 62,850,588 L486P probably benign Het
Trmt1l T G 1: 151,449,976 S391A probably benign Het
Ush2a T A 1: 188,850,057 N3772K probably damaging Het
Vmn1r230 G T 17: 20,846,608 A20S probably benign Het
Wdr76 A G 2: 121,510,698 N75D possibly damaging Het
Zfp977 A G 7: 42,580,678 L141S probably benign Het
Zfp988 A G 4: 147,332,351 D414G probably benign Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 99063985 missense probably damaging 1.00
IGL01126:Dock7 APN 4 98973552 splice site probably benign
IGL01490:Dock7 APN 4 98945118 unclassified probably benign
IGL01553:Dock7 APN 4 98945566 nonsense probably null
IGL01728:Dock7 APN 4 98962331 missense probably damaging 1.00
IGL01776:Dock7 APN 4 98940941 missense possibly damaging 0.65
IGL01954:Dock7 APN 4 99083151 missense probably damaging 0.99
IGL01985:Dock7 APN 4 99023377 missense probably benign 0.35
IGL02054:Dock7 APN 4 98973409 missense probably damaging 1.00
IGL02150:Dock7 APN 4 99079852 splice site probably benign
IGL02153:Dock7 APN 4 98958067 missense probably benign 0.15
IGL02183:Dock7 APN 4 98958991 missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98989234 missense probably benign 0.18
IGL02618:Dock7 APN 4 99083028 missense probably benign 0.00
IGL02634:Dock7 APN 4 98989296 missense probably damaging 1.00
IGL02670:Dock7 APN 4 98966286 splice site probably null
IGL02690:Dock7 APN 4 98969635 missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98987386 missense probably damaging 1.00
IGL02833:Dock7 APN 4 98945495 missense probably damaging 1.00
IGL02858:Dock7 APN 4 98945205 nonsense probably null
IGL02875:Dock7 APN 4 98975994 missense probably benign 0.00
IGL03027:Dock7 APN 4 98977927 missense probably benign
IGL03027:Dock7 APN 4 99070213 missense possibly damaging 0.71
IGL03032:Dock7 APN 4 98966348 missense probably benign 0.02
IGL03104:Dock7 APN 4 98959023 missense possibly damaging 0.60
IGL03136:Dock7 APN 4 99003791 missense probably damaging 1.00
IGL03345:Dock7 APN 4 98984819 missense possibly damaging 0.91
moonlight UTSW 4 large deletion
BB005:Dock7 UTSW 4 99001098 missense
BB015:Dock7 UTSW 4 99001098 missense
PIT4810001:Dock7 UTSW 4 98945559 nonsense probably null
R0086:Dock7 UTSW 4 98945144 missense probably damaging 1.00
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0245:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98984814 missense probably benign 0.07
R0556:Dock7 UTSW 4 98945189 missense probably damaging 1.00
R0612:Dock7 UTSW 4 98989233 missense probably benign 0.31
R0652:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98987479 missense probably benign 0.00
R0681:Dock7 UTSW 4 99016704 missense probably damaging 1.00
R0725:Dock7 UTSW 4 98945291 missense probably damaging 1.00
R0828:Dock7 UTSW 4 99015745 missense probably damaging 1.00
R0837:Dock7 UTSW 4 98989258 missense probably benign 0.01
R0962:Dock7 UTSW 4 98945195 missense possibly damaging 0.85
R1140:Dock7 UTSW 4 99065406 missense possibly damaging 0.82
R1476:Dock7 UTSW 4 99079435 missense possibly damaging 0.52
R1614:Dock7 UTSW 4 99061280 missense probably benign 0.12
R1625:Dock7 UTSW 4 98962196 splice site probably null
R1640:Dock7 UTSW 4 98945246 missense probably damaging 1.00
R1752:Dock7 UTSW 4 98966444 missense probably damaging 1.00
R1941:Dock7 UTSW 4 98984715 missense probably benign 0.09
R2020:Dock7 UTSW 4 98959101 missense probably damaging 1.00
R2092:Dock7 UTSW 4 99009308 missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98966369 missense probably damaging 1.00
R2424:Dock7 UTSW 4 98945307 nonsense probably null
R3767:Dock7 UTSW 4 98970829 missense probably benign
R3768:Dock7 UTSW 4 98970829 missense probably benign
R3769:Dock7 UTSW 4 98970829 missense probably benign
R3770:Dock7 UTSW 4 98970829 missense probably benign
R3917:Dock7 UTSW 4 99016685 missense probably damaging 1.00
R3943:Dock7 UTSW 4 98992431 missense probably damaging 1.00
R4021:Dock7 UTSW 4 99003920 splice site probably null
R4073:Dock7 UTSW 4 99008059 missense probably benign 0.02
R4170:Dock7 UTSW 4 98966401 missense probably damaging 0.99
R4180:Dock7 UTSW 4 99016736 missense probably benign 0.05
R4261:Dock7 UTSW 4 99003886 missense possibly damaging 0.78
R4321:Dock7 UTSW 4 99072454 missense probably damaging 1.00
R4522:Dock7 UTSW 4 98962224 missense probably damaging 1.00
R4582:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98969644 nonsense probably null
R4940:Dock7 UTSW 4 99020077 missense probably damaging 1.00
R5090:Dock7 UTSW 4 98991411 missense probably benign 0.04
R5374:Dock7 UTSW 4 98989038 missense possibly damaging 0.81
R5392:Dock7 UTSW 4 99008006 missense probably damaging 1.00
R5527:Dock7 UTSW 4 98953868 intron probably benign
R5544:Dock7 UTSW 4 98967257 missense probably damaging 1.00
R5556:Dock7 UTSW 4 98944735 missense probably damaging 1.00
R5870:Dock7 UTSW 4 99063962 missense probably benign 0.00
R5899:Dock7 UTSW 4 98991423 missense probably benign
R6360:Dock7 UTSW 4 98969662 missense probably benign 0.02
R6415:Dock7 UTSW 4 98992448 missense probably damaging 1.00
R6468:Dock7 UTSW 4 98967227 missense probably benign 0.15
R6562:Dock7 UTSW 4 98991410 missense probably damaging 0.97
R6613:Dock7 UTSW 4 98977960 missense probably damaging 0.99
R6703:Dock7 UTSW 4 98946672 missense probably damaging 1.00
R6723:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R6786:Dock7 UTSW 4 99061292 missense probably benign 0.42
R7026:Dock7 UTSW 4 99078919 missense probably benign
R7051:Dock7 UTSW 4 98946732 missense probably damaging 1.00
R7074:Dock7 UTSW 4 98945208 missense unknown
R7106:Dock7 UTSW 4 98967326 missense unknown
R7147:Dock7 UTSW 4 98961417 missense unknown
R7257:Dock7 UTSW 4 98973412 missense unknown
R7334:Dock7 UTSW 4 98975943 missense unknown
R7511:Dock7 UTSW 4 99061282 missense
R7511:Dock7 UTSW 4 99079755 nonsense probably null
R7729:Dock7 UTSW 4 99055446 missense
R7928:Dock7 UTSW 4 99001098 missense
R7984:Dock7 UTSW 4 98989066 missense unknown
R8287:Dock7 UTSW 4 98977920 missense unknown
X0027:Dock7 UTSW 4 99003853 missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98945225 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCAGGCAGAAAAGTAGAATGTACC -3'
(R):5'- TGCAAACCCCTCTCTGCTAAG -3'

Sequencing Primer
(F):5'- TATTAGAAGGATCCAAAAGGTCCAAG -3'
(R):5'- AGGTGCCCCTTACCGAAG -3'
Posted On2020-10-20