Incidental Mutation 'R8439:Or4k15'
ID 654177
Institutional Source Beutler Lab
Gene Symbol Or4k15
Ensembl Gene ENSMUSG00000059488
Gene Name olfactory receptor family 4 subfamily K member 15
Synonyms Olfr727, GA_x6K02T2PMLR-5817082-5818056, MOR246-2
MMRRC Submission 067883-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R8439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 50364010-50365044 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50364604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 190 (I190T)
Ref Sequence ENSEMBL: ENSMUSP00000149886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079142] [ENSMUST00000215317]
AlphaFold A2RTN7
Predicted Effect probably benign
Transcript: ENSMUST00000079142
AA Change: I190T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078145
Gene: ENSMUSG00000059488
AA Change: I190T

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 8.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 290 1.5e-7 PFAM
Pfam:7tm_1 41 287 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215317
AA Change: I190T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 79,841,995 (GRCm39) T1043S probably benign Het
Acadvl T A 11: 69,902,554 (GRCm39) K410* probably null Het
Adam8 C T 7: 139,567,762 (GRCm39) G354D probably benign Het
Ahctf1 T C 1: 179,590,175 (GRCm39) E1366G possibly damaging Het
Bahcc1 C A 11: 120,165,415 (GRCm39) Q949K probably benign Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Ccdc141 T A 2: 76,889,894 (GRCm39) Y466F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Cyp4a30b C A 4: 115,314,972 (GRCm39) Q185K probably benign Het
Dlx2 A T 2: 71,375,882 (GRCm39) I147K possibly damaging Het
Dnaaf6rt T A 1: 31,262,349 (GRCm39) D110E probably damaging Het
Dnaaf9 A G 2: 130,612,621 (GRCm39) L482S probably damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,979,841 (GRCm39) probably null Het
Dock7 C A 4: 98,971,266 (GRCm39) V100F Het
Dspp C A 5: 104,325,162 (GRCm39) D508E unknown Het
Duox2 G T 2: 122,128,636 (GRCm39) T4K probably benign Het
Ear1 T C 14: 44,056,704 (GRCm39) N55D probably damaging Het
Echdc1 G C 10: 29,210,242 (GRCm39) E179Q probably damaging Het
Ehbp1 T C 11: 22,046,109 (GRCm39) M547V possibly damaging Het
Erbb2 A G 11: 98,319,798 (GRCm39) N630S possibly damaging Het
Fam227a G A 15: 79,514,271 (GRCm39) S363L possibly damaging Het
Fam98b A G 2: 117,101,381 (GRCm39) R398G unknown Het
Fsip2 G A 2: 82,807,430 (GRCm39) D1250N probably benign Het
Gdnf G T 15: 7,864,134 (GRCm39) E182* probably null Het
Gys2 T C 6: 142,406,921 (GRCm39) H145R probably benign Het
Hcls1 A G 16: 36,767,003 (GRCm39) K69R probably benign Het
Itih5 A G 2: 10,239,869 (GRCm39) N332S probably benign Het
Kcnb2 T A 1: 15,382,934 (GRCm39) Y87N probably damaging Het
Lrriq3 A G 3: 154,893,873 (GRCm39) N525D probably damaging Het
Lsg1 A T 16: 30,380,569 (GRCm39) W623R probably damaging Het
Myo10 A G 15: 25,725,158 (GRCm39) Y243C probably benign Het
Nans T C 4: 46,492,814 (GRCm39) Y81H probably damaging Het
Nup54 T G 5: 92,573,605 (GRCm39) N199T probably benign Het
Or2h1 A G 17: 37,404,664 (GRCm39) L34P probably damaging Het
Or4c126 C T 2: 89,824,348 (GRCm39) L204F probably benign Het
Or5w13 A T 2: 87,524,088 (GRCm39) I46N probably damaging Het
Or7d9 T A 9: 20,197,337 (GRCm39) L122* probably null Het
Pcnt G A 10: 76,256,039 (GRCm39) R734W probably damaging Het
Peg10 T C 6: 4,755,462 (GRCm39) F13L possibly damaging Het
Plcb1 T C 2: 135,091,972 (GRCm39) probably null Het
Ppfibp1 T C 6: 146,902,448 (GRCm39) V285A possibly damaging Het
Prpf39 T C 12: 65,102,036 (GRCm39) V371A possibly damaging Het
Psmb11 G A 14: 54,863,013 (GRCm39) C77Y probably damaging Het
Rrbp1 A G 2: 143,797,053 (GRCm39) L1133P probably benign Het
Slc16a1 G T 3: 104,560,149 (GRCm39) M151I probably benign Het
Tarm1 G T 7: 3,546,037 (GRCm39) Q89K possibly damaging Het
Tas2r116 T C 6: 132,832,540 (GRCm39) I47T probably damaging Het
Tmod3 T C 9: 75,436,680 (GRCm39) D85G probably damaging Het
Trbv14 T C 6: 41,112,299 (GRCm39) L32P probably benign Het
Trim16 T C 11: 62,741,414 (GRCm39) L486P probably benign Het
Trmt1l T G 1: 151,325,727 (GRCm39) S391A probably benign Het
Ush2a T A 1: 188,582,254 (GRCm39) N3772K probably damaging Het
Vmn1r230 G T 17: 21,066,870 (GRCm39) A20S probably benign Het
Wdr76 A G 2: 121,341,179 (GRCm39) N75D possibly damaging Het
Zfp977 A G 7: 42,230,102 (GRCm39) L141S probably benign Het
Zfp988 A G 4: 147,416,808 (GRCm39) D414G probably benign Het
Other mutations in Or4k15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Or4k15 APN 14 50,364,214 (GRCm39) missense probably damaging 1.00
IGL01306:Or4k15 APN 14 50,364,039 (GRCm39) missense probably benign 0.00
ANU23:Or4k15 UTSW 14 50,364,039 (GRCm39) missense probably benign 0.00
R0498:Or4k15 UTSW 14 50,364,750 (GRCm39) missense probably damaging 1.00
R0574:Or4k15 UTSW 14 50,364,139 (GRCm39) missense probably damaging 1.00
R1201:Or4k15 UTSW 14 50,364,813 (GRCm39) missense probably damaging 1.00
R2112:Or4k15 UTSW 14 50,364,080 (GRCm39) missense probably damaging 1.00
R2435:Or4k15 UTSW 14 50,364,211 (GRCm39) missense probably damaging 1.00
R4238:Or4k15 UTSW 14 50,364,889 (GRCm39) missense probably benign
R4611:Or4k15 UTSW 14 50,364,530 (GRCm39) missense probably benign 0.12
R4663:Or4k15 UTSW 14 50,364,939 (GRCm39) missense probably benign 0.00
R4672:Or4k15 UTSW 14 50,364,714 (GRCm39) missense probably benign 0.02
R5022:Or4k15 UTSW 14 50,364,469 (GRCm39) missense possibly damaging 0.78
R5062:Or4k15 UTSW 14 50,364,894 (GRCm39) missense probably damaging 1.00
R5924:Or4k15 UTSW 14 50,364,139 (GRCm39) missense probably damaging 1.00
R6702:Or4k15 UTSW 14 50,364,688 (GRCm39) missense probably damaging 1.00
R6703:Or4k15 UTSW 14 50,364,688 (GRCm39) missense probably damaging 1.00
R7497:Or4k15 UTSW 14 50,364,952 (GRCm39) missense probably benign 0.20
R7615:Or4k15 UTSW 14 50,364,446 (GRCm39) missense probably benign 0.07
R7798:Or4k15 UTSW 14 50,364,895 (GRCm39) missense probably damaging 1.00
R8413:Or4k15 UTSW 14 50,364,827 (GRCm39) missense probably benign 0.19
R8841:Or4k15 UTSW 14 50,364,666 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGCCTCTCCACTACATG -3'
(R):5'- ACACATAGATGAAGATGCATGGTC -3'

Sequencing Primer
(F):5'- TGACAATCATGAGTCGCCGTG -3'
(R):5'- AAATAGTACAACTACAGTGATGTGAG -3'
Posted On 2020-10-20