Incidental Mutation 'R8439:Fam227a'
ID 654181
Institutional Source Beutler Lab
Gene Symbol Fam227a
Ensembl Gene ENSMUSG00000042564
Gene Name family with sequence similarity 227, member A
Synonyms 4933432B09Rik
MMRRC Submission 067883-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R8439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 79493777-79543157 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79514271 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 363 (S363L)
Ref Sequence ENSEMBL: ENSMUSP00000139524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109646] [ENSMUST00000109648] [ENSMUST00000187519] [ENSMUST00000191401] [ENSMUST00000229064] [ENSMUST00000230366]
AlphaFold Q9D3V8
Predicted Effect possibly damaging
Transcript: ENSMUST00000109646
AA Change: S7L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105273
Gene: ENSMUSG00000042564
AA Change: S7L

DomainStartEndE-ValueType
low complexity region 156 175 N/A INTRINSIC
low complexity region 204 211 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109648
AA Change: S363L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105275
Gene: ENSMUSG00000042564
AA Change: S363L

DomainStartEndE-ValueType
Pfam:FWWh 134 295 1.4e-51 PFAM
low complexity region 512 531 N/A INTRINSIC
low complexity region 560 567 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187519
AA Change: S363L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139524
Gene: ENSMUSG00000042564
AA Change: S363L

DomainStartEndE-ValueType
Pfam:FWWh 132 295 1e-47 PFAM
low complexity region 512 531 N/A INTRINSIC
low complexity region 560 567 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191401
Predicted Effect possibly damaging
Transcript: ENSMUST00000229064
AA Change: S359L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000230366
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 79,841,995 (GRCm39) T1043S probably benign Het
Acadvl T A 11: 69,902,554 (GRCm39) K410* probably null Het
Adam8 C T 7: 139,567,762 (GRCm39) G354D probably benign Het
Ahctf1 T C 1: 179,590,175 (GRCm39) E1366G possibly damaging Het
Bahcc1 C A 11: 120,165,415 (GRCm39) Q949K probably benign Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Ccdc141 T A 2: 76,889,894 (GRCm39) Y466F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Cyp4a30b C A 4: 115,314,972 (GRCm39) Q185K probably benign Het
Dlx2 A T 2: 71,375,882 (GRCm39) I147K possibly damaging Het
Dnaaf6rt T A 1: 31,262,349 (GRCm39) D110E probably damaging Het
Dnaaf9 A G 2: 130,612,621 (GRCm39) L482S probably damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,979,841 (GRCm39) probably null Het
Dock7 C A 4: 98,971,266 (GRCm39) V100F Het
Dspp C A 5: 104,325,162 (GRCm39) D508E unknown Het
Duox2 G T 2: 122,128,636 (GRCm39) T4K probably benign Het
Ear1 T C 14: 44,056,704 (GRCm39) N55D probably damaging Het
Echdc1 G C 10: 29,210,242 (GRCm39) E179Q probably damaging Het
Ehbp1 T C 11: 22,046,109 (GRCm39) M547V possibly damaging Het
Erbb2 A G 11: 98,319,798 (GRCm39) N630S possibly damaging Het
Fam98b A G 2: 117,101,381 (GRCm39) R398G unknown Het
Fsip2 G A 2: 82,807,430 (GRCm39) D1250N probably benign Het
Gdnf G T 15: 7,864,134 (GRCm39) E182* probably null Het
Gys2 T C 6: 142,406,921 (GRCm39) H145R probably benign Het
Hcls1 A G 16: 36,767,003 (GRCm39) K69R probably benign Het
Itih5 A G 2: 10,239,869 (GRCm39) N332S probably benign Het
Kcnb2 T A 1: 15,382,934 (GRCm39) Y87N probably damaging Het
Lrriq3 A G 3: 154,893,873 (GRCm39) N525D probably damaging Het
Lsg1 A T 16: 30,380,569 (GRCm39) W623R probably damaging Het
Myo10 A G 15: 25,725,158 (GRCm39) Y243C probably benign Het
Nans T C 4: 46,492,814 (GRCm39) Y81H probably damaging Het
Nup54 T G 5: 92,573,605 (GRCm39) N199T probably benign Het
Or2h1 A G 17: 37,404,664 (GRCm39) L34P probably damaging Het
Or4c126 C T 2: 89,824,348 (GRCm39) L204F probably benign Het
Or4k15 T C 14: 50,364,604 (GRCm39) I190T probably benign Het
Or5w13 A T 2: 87,524,088 (GRCm39) I46N probably damaging Het
Or7d9 T A 9: 20,197,337 (GRCm39) L122* probably null Het
Pcnt G A 10: 76,256,039 (GRCm39) R734W probably damaging Het
Peg10 T C 6: 4,755,462 (GRCm39) F13L possibly damaging Het
Plcb1 T C 2: 135,091,972 (GRCm39) probably null Het
Ppfibp1 T C 6: 146,902,448 (GRCm39) V285A possibly damaging Het
Prpf39 T C 12: 65,102,036 (GRCm39) V371A possibly damaging Het
Psmb11 G A 14: 54,863,013 (GRCm39) C77Y probably damaging Het
Rrbp1 A G 2: 143,797,053 (GRCm39) L1133P probably benign Het
Slc16a1 G T 3: 104,560,149 (GRCm39) M151I probably benign Het
Tarm1 G T 7: 3,546,037 (GRCm39) Q89K possibly damaging Het
Tas2r116 T C 6: 132,832,540 (GRCm39) I47T probably damaging Het
Tmod3 T C 9: 75,436,680 (GRCm39) D85G probably damaging Het
Trbv14 T C 6: 41,112,299 (GRCm39) L32P probably benign Het
Trim16 T C 11: 62,741,414 (GRCm39) L486P probably benign Het
Trmt1l T G 1: 151,325,727 (GRCm39) S391A probably benign Het
Ush2a T A 1: 188,582,254 (GRCm39) N3772K probably damaging Het
Vmn1r230 G T 17: 21,066,870 (GRCm39) A20S probably benign Het
Wdr76 A G 2: 121,341,179 (GRCm39) N75D possibly damaging Het
Zfp977 A G 7: 42,230,102 (GRCm39) L141S probably benign Het
Zfp988 A G 4: 147,416,808 (GRCm39) D414G probably benign Het
Other mutations in Fam227a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Fam227a APN 15 79,518,274 (GRCm39) missense possibly damaging 0.66
IGL01807:Fam227a APN 15 79,533,856 (GRCm39) missense probably benign 0.03
IGL01936:Fam227a APN 15 79,496,747 (GRCm39) missense possibly damaging 0.90
IGL02355:Fam227a APN 15 79,528,139 (GRCm39) intron probably benign
IGL02362:Fam227a APN 15 79,528,139 (GRCm39) intron probably benign
IGL02569:Fam227a APN 15 79,518,323 (GRCm39) missense probably benign
IGL02713:Fam227a APN 15 79,520,997 (GRCm39) splice site probably benign
IGL02734:Fam227a APN 15 79,502,042 (GRCm39) splice site probably benign
IGL02816:Fam227a APN 15 79,510,497 (GRCm39) missense possibly damaging 0.66
IGL03354:Fam227a APN 15 79,520,951 (GRCm39) missense possibly damaging 0.91
R0105:Fam227a UTSW 15 79,505,033 (GRCm39) missense possibly damaging 0.90
R0194:Fam227a UTSW 15 79,524,870 (GRCm39) nonsense probably null
R0437:Fam227a UTSW 15 79,528,189 (GRCm39) missense possibly damaging 0.90
R0786:Fam227a UTSW 15 79,510,469 (GRCm39) missense probably benign 0.01
R0925:Fam227a UTSW 15 79,505,006 (GRCm39) missense probably benign 0.04
R1200:Fam227a UTSW 15 79,496,738 (GRCm39) missense possibly damaging 0.66
R1424:Fam227a UTSW 15 79,518,309 (GRCm39) missense probably benign 0.34
R1474:Fam227a UTSW 15 79,499,582 (GRCm39) missense probably damaging 0.97
R1495:Fam227a UTSW 15 79,510,446 (GRCm39) missense probably benign 0.00
R1561:Fam227a UTSW 15 79,520,963 (GRCm39) missense possibly damaging 0.95
R1661:Fam227a UTSW 15 79,504,878 (GRCm39) splice site probably null
R1669:Fam227a UTSW 15 79,504,878 (GRCm39) splice site probably null
R1967:Fam227a UTSW 15 79,521,335 (GRCm39) missense possibly damaging 0.93
R1976:Fam227a UTSW 15 79,510,477 (GRCm39) missense possibly damaging 0.83
R2197:Fam227a UTSW 15 79,507,668 (GRCm39) missense probably damaging 0.97
R2230:Fam227a UTSW 15 79,499,582 (GRCm39) missense possibly damaging 0.66
R2231:Fam227a UTSW 15 79,499,582 (GRCm39) missense possibly damaging 0.66
R2232:Fam227a UTSW 15 79,499,582 (GRCm39) missense possibly damaging 0.66
R2910:Fam227a UTSW 15 79,520,935 (GRCm39) missense possibly damaging 0.81
R3027:Fam227a UTSW 15 79,532,934 (GRCm39) splice site probably null
R3943:Fam227a UTSW 15 79,505,060 (GRCm39) splice site probably benign
R4811:Fam227a UTSW 15 79,499,628 (GRCm39) missense possibly damaging 0.66
R4845:Fam227a UTSW 15 79,533,912 (GRCm39) missense probably damaging 0.99
R4896:Fam227a UTSW 15 79,521,255 (GRCm39) missense probably benign 0.32
R4934:Fam227a UTSW 15 79,521,262 (GRCm39) missense possibly damaging 0.71
R4941:Fam227a UTSW 15 79,524,204 (GRCm39) critical splice donor site probably null
R5225:Fam227a UTSW 15 79,520,936 (GRCm39) missense possibly damaging 0.90
R5369:Fam227a UTSW 15 79,499,637 (GRCm39) missense probably benign 0.27
R5593:Fam227a UTSW 15 79,524,259 (GRCm39) utr 3 prime probably benign
R6311:Fam227a UTSW 15 79,524,895 (GRCm39) missense probably benign 0.23
R6362:Fam227a UTSW 15 79,527,551 (GRCm39) missense possibly damaging 0.53
R6532:Fam227a UTSW 15 79,520,921 (GRCm39) missense probably benign 0.00
R7239:Fam227a UTSW 15 79,518,263 (GRCm39) critical splice donor site probably null
R7619:Fam227a UTSW 15 79,501,967 (GRCm39) missense probably benign
R7719:Fam227a UTSW 15 79,504,913 (GRCm39) missense possibly damaging 0.53
R8006:Fam227a UTSW 15 79,518,299 (GRCm39) missense possibly damaging 0.61
R8048:Fam227a UTSW 15 79,533,959 (GRCm39) start codon destroyed probably null
R8175:Fam227a UTSW 15 79,524,861 (GRCm39) missense probably damaging 0.97
R9014:Fam227a UTSW 15 79,504,958 (GRCm39) missense possibly damaging 0.96
R9034:Fam227a UTSW 15 79,532,952 (GRCm39) missense probably benign 0.00
R9582:Fam227a UTSW 15 79,501,978 (GRCm39) missense probably benign 0.33
R9613:Fam227a UTSW 15 79,518,284 (GRCm39) missense probably benign 0.09
R9668:Fam227a UTSW 15 79,526,444 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACAACAATGTGCCCTCCGTG -3'
(R):5'- AGTGACACTCCATTGCTGC -3'

Sequencing Primer
(F):5'- TCCGTGCCCAGCTAGTG -3'
(R):5'- GGATGGGTGCAAGTATTTC -3'
Posted On 2020-10-20