Incidental Mutation 'R8441:Npbwr1'
ID654187
Institutional Source Beutler Lab
Gene Symbol Npbwr1
Ensembl Gene ENSMUSG00000033774
Gene Nameneuropeptides B/W receptor 1
SynonymsGpr7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8441 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location5913707-5917398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5917178 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 39 (A39V)
Ref Sequence ENSEMBL: ENSMUSP00000046233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044180]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044180
AA Change: A39V

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046233
Gene: ENSMUSG00000033774
AA Change: A39V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 44 327 1.3e-7 PFAM
Pfam:7TM_GPCR_Srsx 50 324 8.5e-10 PFAM
Pfam:7tm_1 56 309 1e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Homozygous null males develop adult-onset obesity, are hyperphagic, and have decreased energy expenditure and locomotor activity. Plasma levels of glucose, leptin and insulin are elevated in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,257,230 Y1064H possibly damaging Het
Ahrr T C 13: 74,214,063 D567G probably benign Het
Aldh1b1 T A 4: 45,802,465 M1K probably null Het
Ankrd12 A T 17: 66,042,551 S96T probably benign Het
Arhgef10 A T 8: 14,991,237 probably benign Het
BB287469 T G 12: 87,819,614 D98E probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cmpk2 G A 12: 26,477,205 A398T probably benign Het
Cpn2 A G 16: 30,260,031 L284P probably damaging Het
Cubn T C 2: 13,427,847 D1221G probably damaging Het
Dnah7c A G 1: 46,533,238 K957R probably damaging Het
Flnb T A 14: 7,896,488 V893E probably benign Het
Flrt3 C A 2: 140,660,626 V361L probably benign Het
Fnta G A 8: 26,011,181 R104* probably null Het
Ggt1 C T 10: 75,579,351 T233I possibly damaging Het
Gm15448 C A 7: 3,823,302 E231* probably null Het
Gpr37l1 A T 1: 135,167,137 V123E probably damaging Het
Grpel1 A G 5: 36,465,212 R7G probably benign Het
H2-M10.5 A T 17: 36,773,307 I54L probably benign Het
Mapk8ip3 A T 17: 24,920,500 probably benign Het
Mcm3 T C 1: 20,814,466 D271G probably benign Het
Naip6 A G 13: 100,285,757 V1256A possibly damaging Het
Nipbl A G 15: 8,293,115 V2604A probably benign Het
Nlrp1b T A 11: 71,182,378 D213V probably damaging Het
Nr6a1 T C 2: 38,742,876 D191G probably benign Het
Olfml1 T G 7: 107,567,770 V2G probably benign Het
Olfr1282 A T 2: 111,335,786 Y97* probably null Het
Olfr1458 T A 19: 13,102,656 Y216F probably damaging Het
Otof T C 5: 30,380,856 K1175E probably damaging Het
Plekhg2 C T 7: 28,360,866 V989I probably benign Het
Prkcq A G 2: 11,248,226 D229G probably benign Het
Ptprf A T 4: 118,218,058 probably benign Het
Rest G T 5: 77,281,919 Q728H possibly damaging Het
Scube1 A T 15: 83,610,222 I868N probably damaging Het
Spcs3 A G 8: 54,528,340 probably null Het
Speg A G 1: 75,411,332 S1445G possibly damaging Het
Theg C A 10: 79,576,676 R327L probably damaging Het
Tmem145 T C 7: 25,308,775 F261S possibly damaging Het
Trav9d-4 A G 14: 52,983,827 S93G probably benign Het
Trbv5 T A 6: 41,062,583 C41S probably damaging Het
Trpm5 A G 7: 143,072,434 S1131P possibly damaging Het
Ttc28 C T 5: 111,177,641 R313* probably null Het
Ubap2l T C 3: 90,012,700 T853A unknown Het
Xirp2 T C 2: 67,512,815 V1800A possibly damaging Het
Zfhx2 A G 14: 55,066,528 L1333P possibly damaging Het
Other mutations in Npbwr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Npbwr1 APN 1 5916965 missense possibly damaging 0.55
R0140:Npbwr1 UTSW 1 5916621 missense probably damaging 1.00
R0585:Npbwr1 UTSW 1 5916458 missense possibly damaging 0.72
R0827:Npbwr1 UTSW 1 5916789 missense possibly damaging 0.85
R1472:Npbwr1 UTSW 1 5916681 missense probably damaging 1.00
R1646:Npbwr1 UTSW 1 5917254 missense probably benign 0.01
R2001:Npbwr1 UTSW 1 5917175 missense possibly damaging 0.81
R2004:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2005:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2006:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2259:Npbwr1 UTSW 1 5916658 missense probably damaging 1.00
R4172:Npbwr1 UTSW 1 5916936 missense probably damaging 1.00
R5614:Npbwr1 UTSW 1 5916811 missense probably damaging 1.00
R6379:Npbwr1 UTSW 1 5917219 missense probably benign 0.03
R7022:Npbwr1 UTSW 1 5917100 missense probably damaging 1.00
R7462:Npbwr1 UTSW 1 5916932 missense probably damaging 1.00
R7678:Npbwr1 UTSW 1 5916708 missense probably benign 0.03
R8547:Npbwr1 UTSW 1 5917227 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGAGCTTGCACATGACCTCC -3'
(R):5'- CATAAACCTCGAGTTTCGCGG -3'

Sequencing Primer
(F):5'- CAGGAAGTCCGCGATGTTG -3'
(R):5'- GGGCTGCTGAGTGGAATCC -3'
Posted On2020-10-20