Mutagenetix > Incidental Mutation

Incidental Mutation 'R8442:Dnah14'

654232

Institutional Source

Beutler Lab

Gene Symbol

Dnah14

Ensembl Gene

ENSMUSG00000047369

Gene Name

dynein, axonemal, heavy chain 14

Synonyms

A230079K17Rik, Dnahc14, Gm980, LOC381311

MMRRC Submission

067779-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R8442 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

181404158-181642306 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 181568849 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2860 (T2860A)

Ref Sequence

ENSEMBL: ENSMUSP00000146843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000208001]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000208001
AA Change: T2860A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apof	T	C	10: 128,104,891 (GRCm39)	L15P	probably damaging	Het
BC048671	T	C	6: 90,282,095 (GRCm39)	F84S	probably benign	Het
Bsn	G	A	9: 107,988,651 (GRCm39)	A2367V	probably benign	Het
C2cd4a	C	T	9: 67,739,039 (GRCm39)	M1I	probably null	Het
Cd72	T	A	4: 43,450,109 (GRCm39)	K266N	possibly damaging	Het
Col12a1	A	G	9: 79,542,781 (GRCm39)	F2328S	probably damaging	Het
Cubn	T	C	2: 13,318,855 (GRCm39)	Y2948C	probably damaging	Het
Dagla	A	G	19: 10,240,456 (GRCm39)		probably null	Het
Dagla	A	G	19: 10,248,883 (GRCm39)	F24L	probably damaging	Het
Efcab2	A	T	1: 178,265,001 (GRCm39)	K22N	probably benign	Het
Flt1	C	T	5: 147,512,983 (GRCm39)	R1118Q	probably damaging	Het
Foxl1	T	A	8: 121,855,224 (GRCm39)	L175Q	possibly damaging	Het
Gm572	G	T	4: 148,743,450 (GRCm39)	R140L	possibly damaging	Het
Gucy2g	T	C	19: 55,205,833 (GRCm39)	R676G	probably benign	Het
Hmcn2	C	A	2: 31,281,088 (GRCm39)	L1867I	probably benign	Het
Hspb8	T	C	5: 116,560,504 (GRCm39)	Y12C	probably damaging	Het
Igf2bp2	A	C	16: 21,883,841 (GRCm39)		probably null	Het
Igkv9-129	T	A	6: 67,816,784 (GRCm39)	M3K	probably damaging	Het
Il5	C	T	11: 53,612,651 (GRCm39)	P54S	probably damaging	Het
Kif18a	T	C	2: 109,125,318 (GRCm39)	I245T	possibly damaging	Het
Kif2b	T	A	11: 91,467,140 (GRCm39)	N381I	possibly damaging	Het
Lrrc49	A	G	9: 60,500,908 (GRCm39)	F679S	probably benign	Het
Med24	A	G	11: 98,598,383 (GRCm39)	F742L	probably benign	Het
Msh3	T	C	13: 92,349,020 (GRCm39)	T1071A	probably benign	Het
Neb	T	C	2: 52,177,220 (GRCm39)	T1374A	probably damaging	Het
Or4d6	A	T	19: 12,086,091 (GRCm39)	I47N	probably damaging	Het
Or5p75-ps1	A	C	7: 108,107,851 (GRCm39)	Q196P	unknown	Het
P3h2	A	G	16: 25,805,955 (GRCm39)	I296T	probably benign	Het
Pcdhb21	A	T	18: 37,646,841 (GRCm39)		probably benign	Het
Prkab2	G	T	3: 97,566,002 (GRCm39)	G25C	probably damaging	Het
Ptprm	C	A	17: 67,251,312 (GRCm39)	A522S	possibly damaging	Het
Scarf2	A	G	16: 17,624,231 (GRCm39)	D512G	probably benign	Het
Sema3d	A	G	5: 12,592,608 (GRCm39)	T346A	probably damaging	Het
Septin7	T	C	9: 25,163,938 (GRCm39)	S2P	unknown	Het
Sfrp5	A	G	19: 42,187,236 (GRCm39)	V278A	probably benign	Het
Taar1	T	A	10: 23,796,522 (GRCm39)	C73*	probably null	Het
Tek	T	A	4: 94,715,922 (GRCm39)	L448Q	probably benign	Het
Tmem132a	A	C	19: 10,835,833 (GRCm39)	L899R	probably damaging	Het
Txndc5	T	C	13: 38,711,845 (GRCm39)		probably benign	Het
Uck1	C	A	2: 32,150,153 (GRCm39)		probably benign	Het
Uggt1	A	G	1: 36,212,568 (GRCm39)	S925P	probably damaging	Het
Unc13d	A	T	11: 115,958,657 (GRCm39)	D786E	probably damaging	Het
Vmn1r26	T	C	6: 57,985,728 (GRCm39)	T154A	possibly damaging	Het

Other mutations in Dnah14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Dnah14	APN	1	181,579,611 (GRCm39)	missense	probably benign	0.17
IGL01764:Dnah14	APN	1	181,572,342 (GRCm39)	missense	probably benign	0.00
IGL03218:Dnah14	APN	1	181,582,834 (GRCm39)	missense	probably benign	0.02
IGL03290:Dnah14	APN	1	181,591,543 (GRCm39)	splice site	probably benign
IGL03384:Dnah14	APN	1	181,573,514 (GRCm39)	missense	probably benign	0.03
R0009:Dnah14	UTSW	1	181,596,972 (GRCm39)	splice site	probably benign
R0125:Dnah14	UTSW	1	181,579,628 (GRCm39)	missense	probably damaging	0.99
R0579:Dnah14	UTSW	1	181,572,312 (GRCm39)	missense	possibly damaging	0.72
R0973:Dnah14	UTSW	1	181,579,710 (GRCm39)	missense	probably damaging	1.00
R0973:Dnah14	UTSW	1	181,579,710 (GRCm39)	missense	probably damaging	1.00
R0974:Dnah14	UTSW	1	181,579,710 (GRCm39)	missense	probably damaging	1.00
R1609:Dnah14	UTSW	1	181,577,742 (GRCm39)	missense	probably damaging	0.97
R1860:Dnah14	UTSW	1	181,591,525 (GRCm39)	missense	probably damaging	1.00
R2050:Dnah14	UTSW	1	181,580,127 (GRCm39)	missense	probably damaging	1.00
R2974:Dnah14	UTSW	1	181,582,806 (GRCm39)	critical splice acceptor site	probably null
R4715:Dnah14	UTSW	1	181,584,788 (GRCm39)	missense	probably damaging	1.00
R5076:Dnah14	UTSW	1	181,584,799 (GRCm39)	missense	probably benign	0.01
R5424:Dnah14	UTSW	1	181,590,875 (GRCm39)	missense	possibly damaging	0.95
R5808:Dnah14	UTSW	1	181,568,724 (GRCm39)	missense	possibly damaging	0.72
R5997:Dnah14	UTSW	1	181,597,670 (GRCm39)	missense	probably benign	0.00
R6052:Dnah14	UTSW	1	181,494,052 (GRCm39)	missense	possibly damaging	0.50
R6061:Dnah14	UTSW	1	181,536,616 (GRCm39)	missense	probably damaging	1.00
R6089:Dnah14	UTSW	1	181,577,719 (GRCm39)	missense	probably damaging	1.00
R6092:Dnah14	UTSW	1	181,449,398 (GRCm39)	missense	probably benign	0.13
R6145:Dnah14	UTSW	1	181,493,982 (GRCm39)	missense	probably benign	0.00
R6163:Dnah14	UTSW	1	181,493,926 (GRCm39)	missense	probably benign	0.33
R6246:Dnah14	UTSW	1	181,508,453 (GRCm39)	missense	probably benign	0.00
R6302:Dnah14	UTSW	1	181,428,771 (GRCm39)	missense	possibly damaging	0.96
R6306:Dnah14	UTSW	1	181,412,589 (GRCm39)	frame shift	probably null
R6326:Dnah14	UTSW	1	181,611,121 (GRCm39)	missense	probably damaging	1.00
R6348:Dnah14	UTSW	1	181,454,285 (GRCm39)	missense	possibly damaging	0.83
R6367:Dnah14	UTSW	1	181,582,951 (GRCm39)	splice site	probably null
R6376:Dnah14	UTSW	1	181,433,459 (GRCm39)	missense	possibly damaging	0.79
R6389:Dnah14	UTSW	1	181,478,767 (GRCm39)	critical splice donor site	probably null
R6433:Dnah14	UTSW	1	181,479,222 (GRCm39)	missense	probably damaging	0.99
R6454:Dnah14	UTSW	1	181,611,270 (GRCm39)	missense	probably damaging	1.00
R6476:Dnah14	UTSW	1	181,572,333 (GRCm39)	missense	probably benign	0.26
R6523:Dnah14	UTSW	1	181,471,186 (GRCm39)	missense	probably benign	0.00
R6529:Dnah14	UTSW	1	181,494,034 (GRCm39)	missense	probably damaging	0.98
R6538:Dnah14	UTSW	1	181,412,550 (GRCm39)	missense	unknown
R6546:Dnah14	UTSW	1	181,566,552 (GRCm39)	missense	probably damaging	1.00
R6752:Dnah14	UTSW	1	181,421,017 (GRCm39)	missense	probably benign	0.07
R6762:Dnah14	UTSW	1	181,584,824 (GRCm39)	missense	probably damaging	1.00
R6786:Dnah14	UTSW	1	181,468,970 (GRCm39)	missense	probably benign	0.21
R6849:Dnah14	UTSW	1	181,636,510 (GRCm39)	missense	probably benign	0.00
R6877:Dnah14	UTSW	1	181,455,997 (GRCm39)	missense	possibly damaging	0.82
R6912:Dnah14	UTSW	1	181,577,748 (GRCm39)	missense	possibly damaging	0.83
R6919:Dnah14	UTSW	1	181,412,631 (GRCm39)	missense	probably benign	0.04
R6924:Dnah14	UTSW	1	181,455,517 (GRCm39)	missense	probably benign	0.04
R6957:Dnah14	UTSW	1	181,612,740 (GRCm39)	missense	possibly damaging	0.92
R6980:Dnah14	UTSW	1	181,475,795 (GRCm39)	missense	probably benign	0.00
R7018:Dnah14	UTSW	1	181,454,509 (GRCm39)	missense	possibly damaging	0.55
R7046:Dnah14	UTSW	1	181,450,568 (GRCm39)	missense	probably benign	0.01
R7058:Dnah14	UTSW	1	181,525,614 (GRCm39)	missense	probably benign	0.00
R7068:Dnah14	UTSW	1	181,597,355 (GRCm39)	missense	probably benign	0.35
R7115:Dnah14	UTSW	1	181,547,710 (GRCm39)	missense	probably damaging	1.00
R7130:Dnah14	UTSW	1	181,573,523 (GRCm39)	nonsense	probably null
R7165:Dnah14	UTSW	1	181,532,100 (GRCm39)	missense	probably benign	0.00
R7169:Dnah14	UTSW	1	181,529,930 (GRCm39)	missense	probably benign	0.00
R7184:Dnah14	UTSW	1	181,532,094 (GRCm39)	nonsense	probably null
R7232:Dnah14	UTSW	1	181,584,928 (GRCm39)	missense	probably damaging	1.00
R7260:Dnah14	UTSW	1	181,534,309 (GRCm39)	missense	probably damaging	0.99
R7276:Dnah14	UTSW	1	181,513,372 (GRCm39)	missense	probably benign	0.41
R7290:Dnah14	UTSW	1	181,455,739 (GRCm39)	missense	probably benign	0.20
R7314:Dnah14	UTSW	1	181,612,819 (GRCm39)	splice site	probably null
R7326:Dnah14	UTSW	1	181,425,968 (GRCm39)	missense	probably benign	0.02
R7336:Dnah14	UTSW	1	181,625,299 (GRCm39)	missense	probably damaging	0.96
R7363:Dnah14	UTSW	1	181,518,089 (GRCm39)	splice site	probably null
R7371:Dnah14	UTSW	1	181,454,450 (GRCm39)	missense	probably benign	0.05
R7376:Dnah14	UTSW	1	181,590,967 (GRCm39)	missense	probably benign	0.03
R7418:Dnah14	UTSW	1	181,444,307 (GRCm39)	missense	possibly damaging	0.92
R7473:Dnah14	UTSW	1	181,579,704 (GRCm39)	missense	probably damaging	0.99
R7514:Dnah14	UTSW	1	181,455,632 (GRCm39)	missense	probably damaging	0.96
R7555:Dnah14	UTSW	1	181,597,619 (GRCm39)	missense	probably benign	0.26
R7641:Dnah14	UTSW	1	181,535,098 (GRCm39)	missense	probably benign	0.01
R7663:Dnah14	UTSW	1	181,579,720 (GRCm39)	splice site	probably null
R7674:Dnah14	UTSW	1	181,535,098 (GRCm39)	missense	probably benign	0.01
R7680:Dnah14	UTSW	1	181,513,365 (GRCm39)	missense	probably benign	0.15
R7709:Dnah14	UTSW	1	181,530,049 (GRCm39)	critical splice donor site	probably null
R7842:Dnah14	UTSW	1	181,455,463 (GRCm39)	missense	probably damaging	0.99
R7861:Dnah14	UTSW	1	181,444,324 (GRCm39)	missense	probably damaging	1.00
R7988:Dnah14	UTSW	1	181,611,139 (GRCm39)	missense	probably damaging	0.97
R8016:Dnah14	UTSW	1	181,475,876 (GRCm39)	missense	probably benign	0.05
R8042:Dnah14	UTSW	1	181,471,196 (GRCm39)	critical splice donor site	probably null
R8071:Dnah14	UTSW	1	181,443,459 (GRCm39)	missense	possibly damaging	0.84
R8086:Dnah14	UTSW	1	181,593,797 (GRCm39)	missense	probably damaging	1.00
R8095:Dnah14	UTSW	1	181,633,597 (GRCm39)	nonsense	probably null
R8139:Dnah14	UTSW	1	181,582,853 (GRCm39)	missense	probably damaging	1.00
R8176:Dnah14	UTSW	1	181,484,598 (GRCm39)	missense	probably damaging	0.96
R8193:Dnah14	UTSW	1	181,515,770 (GRCm39)	missense	probably damaging	1.00
R8197:Dnah14	UTSW	1	181,517,666 (GRCm39)	missense	possibly damaging	0.94
R8209:Dnah14	UTSW	1	181,623,110 (GRCm39)	missense	possibly damaging	0.69
R8226:Dnah14	UTSW	1	181,623,110 (GRCm39)	missense	possibly damaging	0.69
R8251:Dnah14	UTSW	1	181,492,430 (GRCm39)	missense	probably damaging	1.00
R8264:Dnah14	UTSW	1	181,572,357 (GRCm39)	missense	probably damaging	0.99
R8284:Dnah14	UTSW	1	181,601,376 (GRCm39)	missense	probably benign	0.03
R8289:Dnah14	UTSW	1	181,543,780 (GRCm39)	nonsense	probably null
R8323:Dnah14	UTSW	1	181,532,109 (GRCm39)	missense	probably benign	0.01
R8458:Dnah14	UTSW	1	181,633,577 (GRCm39)	missense
R8507:Dnah14	UTSW	1	181,468,979 (GRCm39)	missense	probably benign	0.02
R8509:Dnah14	UTSW	1	181,642,220 (GRCm39)	missense
R8520:Dnah14	UTSW	1	181,481,203 (GRCm39)	missense	probably damaging	1.00
R8530:Dnah14	UTSW	1	181,492,511 (GRCm39)	missense	probably damaging	1.00
R8703:Dnah14	UTSW	1	181,493,576 (GRCm39)	nonsense	probably null
R8710:Dnah14	UTSW	1	181,517,876 (GRCm39)	missense	probably benign	0.04
R8752:Dnah14	UTSW	1	181,455,581 (GRCm39)	missense	probably benign	0.00
R8792:Dnah14	UTSW	1	181,642,189 (GRCm39)	missense
R8797:Dnah14	UTSW	1	181,465,412 (GRCm39)	missense	probably benign	0.19
R8821:Dnah14	UTSW	1	181,619,569 (GRCm39)	nonsense	probably null
R8834:Dnah14	UTSW	1	181,444,315 (GRCm39)	missense	possibly damaging	0.83
R8913:Dnah14	UTSW	1	181,553,063 (GRCm39)	missense	probably benign	0.01
R8925:Dnah14	UTSW	1	181,508,321 (GRCm39)	missense	probably damaging	1.00
R8927:Dnah14	UTSW	1	181,508,321 (GRCm39)	missense	probably damaging	1.00
R8934:Dnah14	UTSW	1	181,450,288 (GRCm39)	missense	possibly damaging	0.84
R9090:Dnah14	UTSW	1	181,597,325 (GRCm39)	missense	probably benign	0.33
R9169:Dnah14	UTSW	1	181,433,381 (GRCm39)	missense	probably benign	0.06
R9199:Dnah14	UTSW	1	181,478,566 (GRCm39)	missense	possibly damaging	0.50
R9212:Dnah14	UTSW	1	181,628,852 (GRCm39)	missense	possibly damaging	0.95
R9213:Dnah14	UTSW	1	181,444,205 (GRCm39)	critical splice donor site	probably null
R9271:Dnah14	UTSW	1	181,597,325 (GRCm39)	missense	probably benign	0.33
R9282:Dnah14	UTSW	1	181,642,077 (GRCm39)	missense
R9350:Dnah14	UTSW	1	181,562,369 (GRCm39)	missense	possibly damaging	0.79
R9358:Dnah14	UTSW	1	181,536,598 (GRCm39)	missense	probably benign	0.01
R9436:Dnah14	UTSW	1	181,508,348 (GRCm39)	missense	probably damaging	1.00
R9484:Dnah14	UTSW	1	181,625,311 (GRCm39)	missense	probably benign	0.01
R9484:Dnah14	UTSW	1	181,517,773 (GRCm39)	missense	probably benign	0.45
R9486:Dnah14	UTSW	1	181,508,494 (GRCm39)	missense	possibly damaging	0.68
R9546:Dnah14	UTSW	1	181,420,992 (GRCm39)	critical splice acceptor site	probably null
R9547:Dnah14	UTSW	1	181,420,992 (GRCm39)	critical splice acceptor site	probably null
R9578:Dnah14	UTSW	1	181,502,007 (GRCm39)	missense	probably benign	0.16
R9654:Dnah14	UTSW	1	181,593,904 (GRCm39)	missense	probably benign	0.01
R9681:Dnah14	UTSW	1	181,562,414 (GRCm39)	missense	possibly damaging	0.91
R9683:Dnah14	UTSW	1	181,426,509 (GRCm39)	missense	probably benign	0.01
R9687:Dnah14	UTSW	1	181,425,978 (GRCm39)	missense	probably benign	0.01
R9718:Dnah14	UTSW	1	181,450,544 (GRCm39)	missense	probably benign	0.08
R9751:Dnah14	UTSW	1	181,619,610 (GRCm39)	missense	probably damaging	1.00
R9757:Dnah14	UTSW	1	181,513,349 (GRCm39)	missense	probably benign	0.03
RF007:Dnah14	UTSW	1	181,513,374 (GRCm39)	missense	probably benign	0.00
RF012:Dnah14	UTSW	1	181,455,463 (GRCm39)	missense	probably damaging	0.99
Z1176:Dnah14	UTSW	1	181,584,916 (GRCm39)	missense	possibly damaging	0.83
Z1177:Dnah14	UTSW	1	181,517,885 (GRCm39)	missense	probably benign	0.03
Z1177:Dnah14	UTSW	1	181,593,869 (GRCm39)	missense	probably damaging	1.00
Z1177:Dnah14	UTSW	1	181,590,899 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGCCTGTCTACAACTCTG -3'
(R):5'- CTCCCACAGGAAAGGTAGATTTG -3'

Sequencing Primer
(F):5'- GCATCTCAGAATTGCTGGC -3'
(R):5'- CCCACAGGAAAGGTAGATTTGAATTC -3'

Posted On

2020-10-20